Tag Archives: Amazon SageMaker JumpStart

AWS Weekly Roundup: EC2 application status checks, IAM role manager, OpenAI Daybreak on Bedrock, and more (August 17, 2026)

Post Syndicated from Channy Yun (윤석찬) original https://aws.amazon.com/blogs/aws/aws-weekly-roundup-ec2-application-status-checks-iam-role-manager-openai-daybreak-on-bedrock-and-more-august-17-2026/

Last week, the OpenSearch and Valkey teams visited Seoul to meet open source developers and contributors in the Open Source Summit Korea 2026 and MCP DevSummit Seoul 2026. At the four-day event, community leaders and users of open source projects and emerging agent AI gathered to share knowledge, collaborate on solutions, and push the projects forward.

Leaders of the Korean OpenSearch communities volunteered to participate in the booth, and also had time to network and interact in the user group meetup.

OpenSearch is an open source, enterprise-grade search and observability suite that brings order to unstructured data at scale. On June 9, 2026, OpenSearch 3.7 introduced new tools designed to query, alert, and track SLOs across logs, traces, and metrics through a single interface and retrieve vectors up to 5.5x faster for improved search performance. Since July 30, 2026, you can run OpenSearch version 3.7 on Amazon OpenSearch Service for improvements in vector search performance, search relevance, and Query Insights.

Valkey is an open source high-performance key/value datastore that supports a variety of workloads such as caching, message queues, and it can act as a primary database. On May 19, 2026, Valkey 9.1 introduced a redesigned I/O threading model that improves throughput by up to 17% and reduces memory usage for strings under 128 bytes by up to 20%. Since June 23, 2026, you can run Valkey 9.1 in Amazon ElastiCache for node-based clusters, delivering higher throughput, improved memory efficiency, and stronger access control for multi-tenant workloads.

You can meet our open source teams at upcoming OpenSearch and Valkey events.

Last week’s launches
Here are some launches that got my attention:

For a full list of AWS announcements, be sure to keep an eye on the What’s New with AWS page.

Other AWS news
Here are some additional projects and news items you may find interesting:

  • The deprecation of email validation in AWS Certificate Manager: ACM will discontinue support for email-validated public certificates by September 30, 2027. If you use email validation for your ACM public certificates, you need to migrate to DNS validation before that date. For Amazon CloudFront distributions, HTTP validation is also available.
  • The next-generation AWS VPN Client with CLI support and admin controls: You can use a new AWS VPN Client built on OpenVPN3. With the new client, you get full backward compatibility with existing AWS Client VPN endpoints while delivering the automation capabilities and security posture that enterprise networking teams have been asking for.
  • Oracle Exadata on Exascale for Oracle AI Database@AWS: ExaDB-XS brings Exadata-class performance and availability through a consumption-based model. With ExaDB-XS, you can scale compute and storage independently in small increments and pay only for what you consume.

For a full list of AWS blog posts, be sure to keep an eye on the AWS Blogs page.

Learn more about AWS, browse and join upcoming AWS-led in-person and virtual events, startup events, and developer-focused events including AWS Summits and AWS Community Days. Join the AWS Builder Center to connect with builders, share solutions, and access content that supports your development.

That is all for this week. Check back next Monday for another Weekly Roundup!

Channy

Amazon SageMaker AI now hosts NVIDIA Evo-2 NIM microservices

Post Syndicated from Malvika Viswanathan original https://aws.amazon.com/blogs/compute/amazon-sagemaker-ai-now-hosting-nvidia-evo-2-nim-microservices/

This post is co-written with Neel Patel, Abdullahi Olaoye, Kristopher Kersten, Aniket Deshpande from NVIDIA.

Today, we’re excited to announce that the NVIDIA Evo-2 NVIDIA NIM microservice are now listed in Amazon SageMaker JumpStart. You can use this launch to deploy accelerated and specialized NIM microservices to build, experiment, and responsibly scale your drug discovery workflows on Amazon Web Services (AWS).

In this post, we demonstrate how to get started with these models using Amazon SageMaker Studio.

NVIDIA NIM microservices on AWS

NVIDIA NIM integrates closely with AWS managed services, such as Amazon Elastic Compute Cloud (Amazon EC2), Amazon Elastic Kubernetes Service (Amazon EKS), and Amazon SageMaker AI, to support deployment of generative AI models at scale. As part of NVIDIA AI Enterprise, which is available in the AWS Marketplace, NVIDIA NIM is a set of microservices designed to accelerate the deployment of generative AI. These prebuilt containers support a broad spectrum of generative AI models, from open source community models, to NVIDIA Nemotron and custom models. NIM microservices are deployed with just a few lines of code, or with a few actions in the SageMaker Studio console. Engineered to facilitate seamless generative AI inferencing at scale, NIM ensures that generative AI applications can be deployed on various AWS services.

NVIDIA BioNeMo Evo 2 overview

NVIDIA BioNeMo is a platform of NIM microservices, developer tools, and AI models that accelerate building, adapting, and deploying biomolecular AI models for drug discovery. It packages curated training recipes, data loaders, and domain-optimized pretrained models for DNA, RNA, and proteins, alongside NVIDIA CUDA-X libraries such as NVIDIA cuEquivariance. These components power tasks such as 3D structure prediction, de novo design, virtual screening, docking, and property prediction with GPU-accelerated performance.

NVIDIA NIM microservices provide optimized, API-first inference that integrates directly into enterprise pipelines across on-premises and the cloud, providing scalable and secure deployment with faster time-to-market and lower Total Cost of Ownership (TCO). The Evo 2 NIM delivers a 40-billion parameter foundation model (FM) trained on a vast dataset of genomes that can be used to predict protein function, identify mutations, and accelerate bioengineering research. Furthermore, the Evo 2 NIM can be chained with other NIM microservices such as ESMFold to create end-to-end, containerized workflows that cut time-to-insight while streamlining deployment through consistent APIs.

SageMaker Studio overview

SageMaker Studio is a web-based integrated development environment (IDE) for machine learning (ML) that provides a unified visual interface for all of the tools that you need to complete each step of the ML development lifecycle. SageMaker Studio provides complete access, control, and visibility into each step of the ML workflow, from data preparation to model building, training, and deployment.

The key features of SageMaker Studio include:

  • Unified interface: Access all SageMaker capabilities through a single, web-based visual interface
  • Jupyter notebooks: Fully managed Jupyter notebooks with pre-configured kernels for popular ML frameworks
  • Model management: Browse, deploy, and manage models from AWS Marketplace and other sources through an intuitive interface
  • Collaboration: Share notebooks, experiments, and models with your team members
  • Built-in security: Integrated with AWS Identity and Access Management (IAM) for secure access control
  • Cost management: Monitor and control costs with built-in usage tracking and resource management tools

Amazon SageMaker JumpStart overview

SageMaker JumpStart is a fully managed service that offers state-of-the-art foundation models for various use cases such as content writing, code generation, question answering, copywriting, summarization, classification, and information retrieval. It provides a collection of pre-trained models that you can deploy quickly, accelerating the development and deployment of ML applications. One of the key components of SageMaker JumpStart is model hubs, which offer a vast catalog of pre-trained models, such as Mistral, for a variety of tasks. You can now discover and deploy Evo 2 NIM in Amazon SageMaker Studio or programmatically through the SageMaker Python SDK, so you can derive model performance and MLOps controls with Amazon SageMaker AI features such as Amazon SageMaker Pipelines, Amazon SageMaker Debugger, or container logs. The model is deployed in a secure AWS environment and in your VPC, helping to support data security for enterprise security needs.

Prerequisites

Before getting started with deployment, make sure that your IAM service role for SageMaker AI has the SageMakerFullAccess permission policy attached. To deploy the NVIDIA NIM microservices successfully, confirm one of the following:

Make sure that your IAM role has the following permissions, and that you have the authority to make AWS Marketplace subscriptions in the AWS account used:

  • aws-marketplace:ViewSubscriptions
  • aws-marketplace:Unsubscribe
  • aws-marketplace:Subscribe

If your account is already subscribed to the model, then you can skip to the following Deploy section. Otherwise, start by subscribing to the model package and move to the Deploy section after.

Subscribe to the model package

To subscribe to the model package, complete the following steps:

  1. Open the SageMaker Jumpstart portal from the SageMaker AI page.
  2. Search for Evo 2 NIM.
  3. Choose View model, and on the Model details page choose Subscribe. This will take you to the AWS Marketplace listing for the Evo 2 NIM.
  4. On the AWS Marketplace listing page, choose View purchase options, review the purchase terms and choose the Subscribe button if you and your organization agree with EULA, pricing, and support terms.
  5. Choose Continue to with the configuration and choose an AWS Region where you have the service quota for the desired instance type.

A product Amazon Resource Name (ARN) is displayed. This is the model package ARN that you need to specify while creating a deployable model using the SageMaker SDK.

Option 1: Deploy the Evo 2 NIM using SageMaker Studio

The following section outlines how to deploy the EVO 2 NIM using SageMaker Studio.

Getting started with SageMaker Studio

Begin by accessing the AWS Management Console and navigating to the SageMaker AI service. When you’re in the SageMaker AI console, locate Studio in the left navigation panel and choose Open Studio next to your user profile. If you haven’t set up a SageMaker Studio domain yet, then you must create a new domain and user profile first. This launches the web-based SageMaker Studio interface where you can manage all aspects of your ML workflow.

Navigating to model packages

Within SageMaker Studio, look for Models in the left sidebar and choose JumpStart base models tab within the Models interface. This section contains all available model packages in SageMaker JumpStart, including those from the AWS Marketplace

Locating the Evo-2 NIM model

Use the search functionality to find the NVIDIA Evo-2 NIM model by searching for terms such as “Evo-2” or “NVIDIA”. When you locate the model package in the filtered results, choose it to view the Model overview page. This page provides an overview of the model and can have a Notebooks tab that will show a sample notebook that contains an example showing how to use the NIM. You can choose Open in JupyterLab to open the notebook in JupyterLab and use it as a starting point for using the NIM.

Configuring the model deployment

On the model package overview page, choose the Deploy button on the top right to begin the deployment process. You must configure several important settings: provide a unique endpoint name (such as “Evo-2-nim-endpoint”), choose an appropriate instance type (ml.g6e.12xlarge is recommended for optimal performance), set the initial instance count (typically 1 for initial testing), and specify an endpoint configuration name. Review all of these settings carefully before proceeding.

Initiating and monitoring the deployment

After verifying your configuration settings, choose Deploy to start the deployment process for creating a Real-time inferance endpoint. Navigate to the Deployments section and then the Endpoints section in the left sidebar to monitor the deployment progress. The endpoint status initially shows Creating and typically takes 5–10 minutes to complete. You can track the progress and should see the status change to InService once the deployment is successful.

Testing and validation

When your endpoint is deployed and shows the In Service status, you can optionally test it directly through the SageMaker Studio interface. Choose your deployed endpoint from the endpoints list to access the Endpoint summary page. Scroll down and select the Playground tab. If available, you will see two options: Test the sample request and Use Python SDK example code. You can use either option to validate the deployment by using a sample protein sequence. This validates the endpoint is working correctly before integrating it into your applications.

Option 2: Deploy Evo 2 using the SageMaker SDK

In this section we walk through deploying the Evo-2 NIM through the SageMaker SDK. Make sure that you have the account-level service limit for using ml.g6e.12xlarge for endpoint usage as one or more instances. Furthermore, NVIDIA provides a list of supported instance types that support deployment. Refer to the AWS Marketplace listing for the model to see the supported instance types. To request a service quota increase, go to the AWS service quotas.

import sagemaker
import boto3
from sagemaker import ModelPackage, get_execution_role
import json
# Initialize SageMaker session and role
role = get_execution_role()
sagemaker_session = sagemaker.Session()
# Model Package ARN from your AWS Marketplace subscription
# Replace this with your actual Model Package ARN after subscription
model_package_arn = "arn:aws:sagemaker:<region>:<account-id>:model-package/Evo-2-nim-model"
# Create model from AWS Marketplace Model Package
model = ModelPackage(
    role=role, 
    model_package_arn=model_package_arn,
    sagemaker_session=sagemaker_session
)
# Deploy the model to an endpoint
predictor = model.deploy(
    initial_instance_count=1,
    instance_type="ml.g6e.12xlarge",  # Using recommended NVIDIA GPU instance
    endpoint_name="Evo-2-endpoint",
    wait=True
)

Run Inference with Evo 2 SageMaker endpoint

When you have the model, you can use a sample text to do an inference request. NIM on SageMaker supports the OpenAI API inference protocol inference request format. For an explanation of the supported parameters, go to the Evo-2 API documentation.

Real-time inference example

sm_runtime = boto3.client("sagemaker-runtime", region_name=region)

generate_payload = {

 "sequence": "ACGTACGTACGT",

 "num_tokens": 100,

 "temperature": 0.7,

 "top_k": 3,

}

response = sm_runtime.invoke_endpoint(

EndpointName='Evo2-40b-2-1-0',

ContentType="application/json",

Body=json.dumps(generate_payload),

)

result = json.loads(response["Body"].read())

print("Generated DNA:", result["sequence"])
print("Elapsed (ms):", result.get("elapsed_ms"))

Example output:

Generated DNA: ACGTACATATGTTCGTACATTCGCACAGACGCCATTTTGAAAAATGCTTTAAATGGATTCAGAATTGGTCAAAATGCATAAATCCATCAAAATTTTTTTC
Elapsed (ms): 10770

Cleaning up

To avoid unwanted charges, complete the steps in this section to clean up your resources.

Deleting the endpoint from SageMaker Studio

In SageMaker Studio, navigate to the Endpoints section in the left sidebar under Inference to view all your active endpoints. Locate your Evo-2 NIM endpoint in the list and select it to open the endpoint details page. On this page, there is a Delete button. Choose Delete and confirm the deletion when prompted. The endpoint status changes to Deleting and disappears from your endpoints list when the deletion is complete. This process typically takes a few minutes, and when it’s deleted the endpoint stops incurring charges immediately.

Delete the SageMaker endpoint

The SageMaker endpoint that you deployed incurs costs if you leave it running. Use the following code to delete the endpoint if you want to stop incurring charges. For more details, go to Delete endpoints and resources.

# Delete endpoint when done (important for cost management)
predictor.delete_endpoint()

Conclusion

The availability of NVIDIA Evo-2 NIM microservices on Amazon SageMaker Jumpstart represents a significant advancement for researchers and organizations working in drug discovery. This solution provides GPU-accelerated multiple sequence alignments and dramatically speeds up structure prediction pipelines that are critical for protein design and antibody research. Users can implement the flexible deployment options—through SageMaker Studio, or SageMaker SDK—to choose the approach that best fits their workflow and technical expertise. The optimized performance of these NIM microservices, combined with the scalability and security of SageMaker, enables faster time-to-insight while streamlining the deployment of complex biomolecular AI models. We encourage you to try the Evo-2 NIM today and look out for future release of MSA-search and Boltz-2 NIMs to accelerate your drug discovery workflows and use the power of NVIDIA’s specialized microservices on AWS infrastructure.

OpenAI open weight models now available on AWS

Post Syndicated from Danilo Poccia original https://aws.amazon.com/blogs/aws/openai-open-weight-models-now-available-on-aws/

AWS is committed to bringing you the most advanced foundation models (FMs) in the industry, continuously expanding our selection to include groundbreaking models from leading AI innovators so that you always have access to the latest advancements to drive your business forward.

Today, I am happy to announce the availability of two new OpenAI models with open weights in Amazon Bedrock and Amazon SageMaker JumpStart. OpenAI gpt-oss-120b and gpt-oss-20b models are designed for text generation and reasoning tasks, offering developers and organizations new options to build AI applications with complete control over their infrastructure and data.

These open weight models excel at coding, scientific analysis, and mathematical reasoning, with performance comparable to leading alternatives. Both models support a 128K context window and provide adjustable reasoning levels (low/medium/high) to match your specific use case requirements. The models support external tools to enhance their capabilities and can be used in an agentic workflow, for example, using a framework like Strands Agents.

With Amazon Bedrock and Amazon SageMaker JumpStart, AWS gives you the freedom to innovate with access to hundreds of FMs from leading AI companies, including OpenAI open weight models. With our comprehensive selection of models, you can match your AI workloads to the perfect model every time.

Through Amazon Bedrock, you can seamlessly experiment with different models, mix and match capabilities, and switch between providers without rewriting code—turning model choice into a strategic advantage that helps you continuously evolve your AI strategy as new innovations emerge. At launch, these new models are available in Bedrock via an OpenAI compatible endpoint. You can point the OpenAI SDK to this endpoint or use the Bedrock InvokeModel and Converse API.

With SageMaker JumpStart, you can quickly evaluate, compare, and customize models for your use case. You can then deploy the original or the customized model in production with the SageMaker AI console or using the SageMaker Python SDK.

Let’s see how these work in practice.

Getting started with OpenAI open weight models in Amazon Bedrock
In the Amazon Bedrock console, I choose Model access from the Configure and learn section of the navigation pane. Then, I navigate to the two listed OpenAI models on this page and request access.

Console screenshot

Now that I have access, I use the Chat/Test playground to test and evaluate the models. I select OpenAI as the category and then the gpt-oss-120b model.

Console screenshot

Using this model, I run the following sample prompt:

A family has $5,000 to save for their vacation next year. They can place the money in a savings account earning 2% interest annually or in a certificate of deposit earning 4% interest annually but with no access to the funds until the vacation. If they need $1,000 for emergency expenses during the year, how should they divide their money between the two options to maximize their vacation fund?

This prompt generates an output that includes the chain of thought used to produce the result.

I can use these models with the OpenAI SDK by configuring the API endpoint (base URL) and using an Amazon Bedrock API key for authentication. For example, I set this environment variables to use the US West (Oregon) AWS Region endpoint (us-west-2) and my Amazon Bedrock API key:

export OPENAI_API_KEY="<my-bedrock-api-key>"
export OPENAI_BASE_URL="https://bedrock-runtime.us-west-2.amazonaws.com/openai/v1"

Now I invoke the model using the OpenAI Python SDK.

client = OpenAI()

response = client.chat.completion.create(
    messages=[{
        "role": "user",
        "content": "Hello, how are you?"
    }],
    model="openai.gpt-oss-120b-1:0",
    stream=True
)

for item in response:
    print(item)

To build an AI agent, I can choose any framework that supports the Amazon Bedrock API or the OpenAI API. For example, here’s the starting code for Strands Agents using the Amazon Bedrock API:

from strands import Agent
from strands.models import BedrockModel
from strands_tools import calculator

model = BedrockModel(
    model_id="openai.gpt-oss-120b-1:0"
)
agent = Agent(
    model=model,
    tools=[calculator]
)

agent("Tell me the square root of 42 ^ 3")

I save the code (app.py file), install the dependencies, and run the agent locally:

pip install strands-agents strands-agents-tools
python app.py

When I am satisfied with the agent, I can deploy in production using the capabilities offered by Amazon Bedrock AgentCore, including a fully managed serverless runtime and memory and identity management.

Getting started with OpenAI open weight models in Amazon SageMaker JumpStart
In the Amazon SageMaker AI console, you can use OpenAI open weight models in the SageMaker Studio. The first time I do this, I need to set up a SageMaker domain. There are options to set it up for a single user (simpler) or an organization. For these tests, I use a single user setup.

In the SageMaker JumpStart model view, I have access to a detailed description of the gpt-oss-120b or gpt-oss-20b model.

I choose the gpt-oss-20b model and then deploy the model. In the next steps, I select the instance type and the initial instance count. After a few minutes, the deployment creates an endpoint that I can then invoke in SageMaker Studio and using any AWS SDKs.

To learn more, visit GPT OSS models from OpenAI are now available on SageMaker JumpStart in the AWS Artificial Intelligence Blog.

Things to know
The new OpenAI open weight models are now available in Amazon Bedrock in the US West (Oregon) AWS Region, while Amazon SageMaker JumpStart supports these models in US East (Ohio, N. Virginia) and Asia Pacific (Mumbai, Tokyo).

Each model comes equipped with full chain-of-thought output capabilities, providing you with detailed visibility into the model’s reasoning process. This transparency is particularly valuable for applications requiring high levels of interpretability and validation. These models give you the freedom to modify, adapt, and customize them to your specific needs. This flexibility allows you to fine-tune the models for your unique use cases, integrate them into your existing workflows, and even build upon them to create new, specialized models tailored to your industry or application.

Security and safety are built into the core of these models, with comprehensive evaluation processes and safety measures in place. The models maintain compatibility with the standard GPT-4 tokenizer.

Both models can be used in your preferred environment, whether that’s through the serverless experience of Amazon Bedrock or the extensive machine learning (ML) development capabilities of SageMaker JumpStart. For information about the costs associated with using these models and services, visit the Amazon Bedrock pricing and Amazon SageMaker AI pricing pages.

To learn more, see the parameters for the models and the chat completions API in the Amazon Bedrock documentation.

Get started today with OpenAI open weight models on AWS in the Amazon Bedrock console or in Amazon SageMaker AI console.

Danilo

AWS Weekly Roundup: AWS Developer Day, Trust Center, Well-Architected for Enterprises, and more (Feb 17, 2025)

Post Syndicated from Channy Yun (윤석찬) original https://aws.amazon.com/blogs/aws/aws-weekly-roundup-aws-developer-day-trust-center-well-architected-for-enterprises-and-more-feb-17-2025/

Join us for the AWS Developer Day on February 20! This virtual event is designed to help developers and teams incorporate cutting-edge yet responsible generative AI across their development lifecycle to accelerate innovation.

In his keynote, Jeff Barr, Vice President of AWS Evangelism, shares his thoughts on the next generation of software development based on generative AI, the skills needed to thrive in this changing environment, and how he sees it evolving in the future.

Get a first look at exciting technical deep-dive and product updates about Amazon Q Developer, AWS Amplify, and GitLab Duo with Amazon Q. You get the chance to explore real-world use cases, live coding demos, interactive sessions, and community spotlight sessions with Christian Bonzelet (AWS Community Builder), Hazel Saenz (AWS Serverless Hero), Matt Lewis (AWS Data Hero), and Johannes Koch (AWS DevTools Hero). Please sign up for this event now!

Last week’s launches
Here are some launches that got my attention:

Updating AWS SDK defaults for AWS STS – As we shared upcoming changes to the AWS Security Token Service (AWS STS) global endpoint to improve the resiliency and performance of your applications, we’re updating two defaults of AWS Software Development Kits (AWS SDKs) and AWS Command Line Interfaces (AWS CLIs) on July 31st 2025 – the default AWS STS service to regional, and the default retry strategy to standard. We recommend that you test your application before the release to avoid an unexpected experience after updating.

Introducing the AWS Trust CenterChris Betz, CISO at Amazon Web Services (AWS), shared AWS Trust Center, a new online resource communicating how we approach securing your assets in the cloud. This resource is a window into our security practices, compliance programs, and data protection controls that demonstrates how we work to earn your trust every day.

AWS CloudTrail network activity events for VPC endpoint – This feature provides you with a powerful tool to enhance your security posture, detect potential threats, and gain deeper insights into your VPC network traffic. This feature addresses your critical needs for comprehensive visibility and control over your AWS environments.

AWS Verified Access support for non-HTTP resources – AWS Verified Access now extends beyond HTTP apps to provide VPN-less, secure access to non-HTTP resources like Amazon Relational Database Service (Amazon RDS) databases, enabling improved security and enhanced user experience for both web applications and database connections. To learn more, visit the Verified Access endpoints page and a video tutorial.

New subnet management of Network Load Balancer (NLB) – NLBs were previously restricted to only adding subnets in new Availability Zones, and they now support full subnet management, including removal of subnets, matching the capabilities of Application Load Balancer (ALB). This enhancement offers organizations greater control over their network architecture and brings consistency to AWS load balancing services.

Meta SAM 2.1 and Falcon 3 models in Amazon SageMaker JumpStart – You can use Meta’s Segment Anything Model (SAM) 2.1 with state-of-the-art video and image segmentation capabilities in a single model. You can also use the Falcon 3 family with five models ranging from 1 to 10 billion parameters, with a focus on enhancing science, math, and coding capabilities. To learn more, visit SageMaker JumpStart pretrained models and Getting started with Amazon SageMaker JumpStart.

For a full list of AWS announcements, be sure to keep an eye on the What’s New with AWS? page.

Other AWS news
Here are some additional news items that you might find interesting:

AWS Documentation updateGreg Wilson, a lead of AWS Documentation, SDK, and CLI teams shared an insightful blog post about the progress, challenges, and what’s next for technical documentation for 200+ AWS services. It includes AWS Decision Guides for choosing the right service for specific needs; optimizing documents for readability, such as doubled code samples; and improving usability, such as dark mode and auto-suggest with top global navigation controls. You can also learn about how we use generative AI to help create technical documents.

AWS Well-Architected for Enterprises – This is a new free digital course designed for technical professionals who architect, build, and operate AWS solutions at scale. This intermediate-level course will help you optimize your cloud architecture while aligning to your business goals. The course takes approximately 1 hour to complete and includes a knowledge check at the end to reinforce your learning.

Integrating AWS with .NET Aspire – The .NET team at AWS has been working on integrations for connecting your .NET applications to AWS resources. Learn about how to automatically deploy AWS application resources using Aspire.Hosting.AWS NuGet package for NET Aspire, an open source framework building cloud-ready applications.

Upcoming AWS events
Check your calendars and sign up for these upcoming AWS events:

AWS Innovate: Generative AI + Data – Join a free online conference focusing on generative AI and data innovations. Available in multiple geographic regions: APJC and EMEA (March 6), North America (March 13), Greater China Region (March 14), and Latin America (April 8).

AWS Summits – Join free online and in-person events that bring the cloud computing community together to connect, collaborate, and learn about AWS. Register in your nearest city: Paris (April 9), Amsterdam (April 16), London (April 30), and Poland (May 5).

AWS GenAI Lofts – GenAI Lofts offer collaborative spaces and immersive experiences for startups and developers. You can join in-person GenAI Loft San Francisco events such as Built on Amazon Bedrock demo nights (April 19), SageMaker Unified Studio Demo for Startups (April 21), and Hands-on with Agentic Graph RAG Workshop (April 25). GenAI Loft Berlin has its Opening Day on February 24 and goes to March 7.

AWS Community Days – Join community-led conferences that feature technical discussions, workshops, and hands-on labs led by expert AWS users and industry leaders from around the world: Karachi, Pakistan (February 22), Milan, Italy (April 2), Bay Area – Security Edition (April 4), Timișoara, Romania (April 10), and Prague, Czeh Republic (April 29).

AWS re:Inforce – Mark your calendars for AWS re:Inforce (June 16–18) in Philadelphia, PA. AWS re:Inforce is a learning conference focused on AWS security solutions, cloud security, compliance, and identity. You can subscribe for event updates now!

You can browse all upcoming in-person and virtual events.

That’s all for this week. Check back next Monday for another Weekly Roundup!

Channy

This post is part of our Weekly Roundup series. Check back each week for a quick roundup of interesting news and announcements from AWS!

AWS Weekly Roundup: AWS BuilderCards at re:Invent 2024, AWS Community Day, Amazon Bedrock, vector databases, and more (Nov 18, 2024)

Post Syndicated from Elizabeth Fuentes original https://aws.amazon.com/blogs/aws/aws-weekly-roundup-aws-buildercards-at-reinvent-2024-aws-community-day-amazon-bedrock-vector-databases-and-more-nov-18-2024/

This week, we wrapped up the final 2024 Latin America Amazon Web Services (AWS) Community Days of the year in Brazil, with multiple parallel events taking place. In Goiânia, we had Marcelo Palladino, senior developer advocate, and Marcelo Paiva, AWS Community Builder, as keynote speakers. Florianópolis feature Ana Cunha, senior developer advocate, and in Santiago de Chile, I had the honor to share the stage with Rossana Suarez, AWS Container Hero, as keynote speakers. These events, organized by communities for communities, provide opportunities to network, learn something new, and immerse yourself in the community. In a community, everyone grows together, and no one is left behind.

AWS Lambda celebrates its 10th anniversary, the service that introduced me to AWS and remains my favorite. Born from customer needs, it revolutionized cloud computing by allowing code execution without server management. Since its inception, documented in this LinkedIn post by Dr. Werner Vogels, Chief Technology Officer at Amazon.com, through the original PR/FAQ document, the service has grown significantly, introducing features such as 1ms billing precision and support for 10GB memory. Thank you AWS Lambda, here’s to many more anniversaries.

Amazon invests $110 million to support AI research at universities using Trainium chips. The initiative provides computing resources using AWS Trainium chips, enabling researchers to develop new AI architectures and machine learning innovations that will be open-sourced for broader advancement. Check out the Linkedin post by Matt Garman, CEO at AWS.

Last week’s launches
AWS BuilderCards second edition at re:Invent 2024Jeff Barr announced the launch of the second edition of AWS BuilderCards at re:Invent 2024. It includes improvements to the design and game mechanics, plus a new add-on pack on generative AI. Over 15,000 sets have been distributed at previous events, with excellent user feedback. They’ll be available for online purchase after re:Invent.

Amazon EventBridge announces up to 94% improvement in end-to-end latency for Event BusesAmazon EventBridge has improved end-to-end latency for Event Buses by up to 94%, reducing average latency from 2235.23ms (measured in January 2023) to 129.33ms (measured in August 2024 at P99). This enhancement enables faster processing for time-sensitive applications such as fraud detection, industrial automation, and gaming across all AWS Regions where Amazon EventBridge is available, including the AWS GovCloud (US) Regions, at no additional cost to you.

Introducing resource control policies (RCPs), a new type of authorization policy in AWS OrganizationsResource control policies (RCPs), a new authorization policy in AWS Organizations. RCPs allow centralized control over maximum permissions granted to resources, complementing service control policies (SCPs) that control permissions for principals. RCPs can restrict external access to resources like Amazon Simple Storage Service (Amazon S3) buckets, enforcing a data perimeter across the organization.

Replicate changes from databases to Apache Iceberg tables using Amazon Data Firehose (in preview) – A new preview capability in Amazon Data Firehose that captures and replicates database changes to Apache Iceberg tables on Amazon S3. This feature supports PostgreSQL and MySQL databases, providing a simple solution to stream database updates without impacting performance. It automatically handles data partitioning and schema evolution, eliminating the need for complex ETL processes.

Amazon S3 now supports up to 1 million buckets per AWS account– Amazon S3 has increased its default bucket quota from 100 to 10,000 per AWS account. Customers can now request increases up to 1 million buckets. The first 2,000 buckets are free, with a small monthly fee applying thereafter for additional buckets.

Amazon Keyspaces (for Apache Cassandra) reduces prices by up to 75%Amazon Keyspaces (for Apache Cassandra) announces significant price reductions of up to 75%. The service reduces on-demand mode pricing by up to 56% for single-region and 65% for multi-region usage. Time-to-live (TTL) delete prices are also reduced by 75%.

Centrally managing root access for customers using AWS OrganizationsAWS Identity and Access Management (IAM) launches a new capability for centrally managing root access in AWS Organizations. This feature allows security teams to remove long-term root credentials from member accounts and use temporary, task-scoped root sessions for specific actions. The solution enhances security by eliminating permanent root credentials while maintaining the ability to perform necessary privileged operations.

Amazon DynamoDB reduces prices for on-demand throughput and global tablesAmazon DynamoDB announces significant price reductions, cutting on-demand mode throughput costs by 50% and global tables by up to 67%. Multi-region replicated writes now match single-region pricing. These changes make on-demand mode the recommended choice for most DynamoDB workloads.

Amazon Q Developer plugins for Datadog and Wiz now generally availableAmazon Q Developer now offers plugins for Datadog and Wiz services, allowing users to access these partners features directly through the AWS Console. Users can query information using natural language commands like @datadog or @wiz to get real-time updates and security insights.

Other AWS blog posts
Here are some additional projects and blog posts that you might find interesting:

Introducing Stable Diffusion 3.5 Large in Amazon SageMaker JumpStart – This powerful 8.1 billion parameter model enables high-quality, photorealistic image generation from text prompts. Customers can seamlessly deploy and use the model in Amazon SageMaker JumpStart, benefiting from Amazon SageMaker security and machine learning operations (MLOps) capabilities.

Transcribe, translate, and summarize live streams in your browser with AWS AI and generative AI services – This blog post explains how we developed a Chrome extension that uses AI services to enhance live streaming experiences. The extension use Amazon Transcribe, Amazon Translate, and Amazon Bedrock to provide real-time transcription, translation, and summarization of live streams directly in the browser. It supports over 50 languages for transcription and 75 for translation, making content globally accessible.

Simplify automotive damage processing with Amazon Bedrock and vector databases –This blog post presents a solution combining Amazon Bedrock and vector databases to streamline automotive damage assessment. The system uses AI to analyze vehicle damage images, provide cost estimates, and match with similar cases from existing datasets. It use Anthropic’s Claude 3 and Amazon Titan Multimodal Embeddings, for efficient, accurate processing.

Revolutionize trip planning with Amazon Bedrock and Amazon Location Service – Amazon Bedrock and Amazon OpenSearch Service vector databases combine to automate automotive damage assessment, using AI to analyze images and match them with historical data for accurate repair estimates.

Upcoming AWS events
Check your calendars and sign up for upcoming AWS events:

AWS Community Days – Join community-led conferences featuring technical discussions, workshops, and hands-on labs driven by expert AWS users and industry leaders from around the world. Upcoming AWS Community Days are scheduled for November 23 in Indonesia, and on December 14 in Kochi, India.

AWS re:Invent 2024 – Join us in Las Vegas to learn all things AWS. Our annual conference is the best—and fastest—way to grow your skills. If you can’t join us in person, you can attend virtually by registering at
Watch re:Invent online.

Browse all upcoming AWS led in-person and virtual events and developer-focused events.

Create your AWS Builder ID and reserve your alias. Builder ID is a universal login credential that gives users access to AWS tools and resources, including over 600 free training courses, community features, and developer tools such as Amazon Q Developer beyond the AWS Management Console.

That’s all for this week. Check back next Monday for another Weekly Roundup!

Thanks to Odina Jacobs for the AWS Community Chile photo.

Eli

This post is part of our Weekly Roundup series. Check back each week for a quick roundup of interesting news and announcements from AWS!

Introducing Llama 3.2 models from Meta in Amazon Bedrock: A new generation of multimodal vision and lightweight models

Post Syndicated from Danilo Poccia original https://aws.amazon.com/blogs/aws/introducing-llama-3-2-models-from-meta-in-amazon-bedrock-a-new-generation-of-multimodal-vision-and-lightweight-models/

In July, we announced the availability of Llama 3.1 models in Amazon Bedrock. Generative AI technology is improving at incredible speed and today, we are excited to introduce the new Llama 3.2 models from Meta in Amazon Bedrock.

Llama 3.2 offers multimodal vision and lightweight models representing Meta’s latest advancement in large language models (LLMs) and providing enhanced capabilities and broader applicability across various use cases. With a focus on responsible innovation and system-level safety, these new models demonstrate state-of-the-art performance on a wide range of industry benchmarks and introduce features that help you build a new generation of AI experiences.

These models are designed to inspire builders with image reasoning and are more accessible for edge applications, unlocking more possibilities with AI.

The Llama 3.2 collection of models are offered in various sizes, from lightweight text-only 1B and 3B parameter models suitable for edge devices to small and medium-sized 11B and 90B parameter models capable of sophisticated reasoning tasks including multimodal support for high resolution images. Llama 3.2 11B and 90B are the first Llama models to support vision tasks, with a new model architecture that integrates image encoder representations into the language model. The new models are designed to be more efficient for AI workloads, with reduced latency and improved performance, making them suitable for a wide range of applications.

All Llama 3.2 models support a 128K context length, maintaining the expanded token capacity introduced in Llama 3.1. Additionally, the models offer improved multilingual support for eight languages including English, German, French, Italian, Portuguese, Hindi, Spanish, and Thai.

In addition to the existing text capable Llama 3.1 8B, 70B, and 405B models, Llama 3.2 supports multimodal use cases. You can now use four new Llama 3.2 models — 90B, 11B, 3B, and 1B — from Meta in Amazon Bedrock to build, experiment, and scale your creative ideas:

Llama 3.2 90B Vision (text + image input) – Meta’s most advanced model, ideal for enterprise-level applications. This model excels at general knowledge, long-form text generation, multilingual translation, coding, math, and advanced reasoning. It also introduces image reasoning capabilities, allowing for image understanding and visual reasoning tasks. This model is ideal for the following use cases: image captioning, image-text retrieval, visual grounding, visual question answering and visual reasoning, and document visual question answering.

Llama 3.2 11B Vision (text + image input) – Well-suited for content creation, conversational AI, language understanding, and enterprise applications requiring visual reasoning. The model demonstrates strong performance in text summarization, sentiment analysis, code generation, and following instructions, with the added ability to reason about images. This model use cases are similar to the 90B version: image captioning, image-text-retrieval, visual grounding, visual question answering and visual reasoning, and document visual question answering.

Llama 3.2 3B (text input) – Designed for applications requiring low-latency inferencing and limited computational resources. It excels at text summarization, classification, and language translation tasks. This model is ideal for the following use cases: mobile AI-powered writing assistants and customer service applications.

Llama 3.2 1B (text input) – The most lightweight model in the Llama 3.2 collection of models, perfect for retrieval and summarization for edge devices and mobile applications. This model is ideal for the following use cases: personal information management and multilingual knowledge retrieval.

In addition, Llama 3.2 is built on top of the Llama Stack, a standardized interface for building canonical toolchain components and agentic applications, making building and deploying easier than ever. Llama Stack API adapters and distributions are designed to most effectively leverage the Llama model capabilities and it gives customers the ability to benchmark Llama models across different vendors.

Meta has tested Llama 3.2 on over 150 benchmark datasets spanning multiple languages and conducted extensive human evaluations, demonstrating competitive performance with other leading foundation models. Let’s see how these models work in practice.

Using Llama 3.2 models in Amazon Bedrock
To get started with Llama 3.2 models, I navigate to the Amazon Bedrock console and choose Model access on the navigation pane. There, I request access for the new Llama 3.2 models: Llama 3.2 1B, 3B, 11B Vision, and 90B Vision.

To test the new vision capability, I open another browser tab and download from the Our World in Data website the Share of electricity generated by renewables chart in PNG format. The chart is very high resolution and I resize it to be 1024 pixel wide.

Back in the Amazon Bedrock console, I choose Chat under Playgrounds in the navigation pane, select Meta as the category, and choose the Llama 3.2 90B Vision model.

I use Choose files to select the resized chart image and use this prompt:

Based on this chart, which countries in Europe have the highest share?

I choose Run and the model analyzes the image and returns its results:

Using Meta Llama 3.2 models in the Amazon Bedrock console

I can also access the models programmatically using the AWS Command Line Interface (AWS CLI) and AWS SDKs. Compared to using the Llama 3.1 models, I only need to update the model IDs as described in the documentation. I can also use the new cross-region inference endpoint for the US and the EU Regions. These endpoints work for any Region within the US and the EU respectively. For example, the cross-region inference endpoints for the Llama 3.2 90B Vision model are:

  • us.meta.llama3-2-90b-instruct-v1:0
  • eu.meta.llama3-2-90b-instruct-v1:0

Here’s a sample AWS CLI command using the Amazon Bedrock Converse API. I use the --query parameter of the CLI to filter the result and only show the text content of the output message:

aws bedrock-runtime converse --messages '[{ "role": "user", "content": [ { "text": "Tell me the three largest cities in Italy." } ] }]' --model-id us.meta.llama3-2-90b-instruct-v1:0 --query 'output.message.content[*].text' --output text

In output, I get the response message from the "assistant".

The three largest cities in Italy are:

1. Rome (Roma) - population: approximately 2.8 million
2. Milan (Milano) - population: approximately 1.4 million
3. Naples (Napoli) - population: approximately 970,000

It’s not much different if you use one of the AWS SDKs. For example, here’s how you can use Python with the AWS SDK for Python (Boto3) to analyze the same image as in the console example:

import boto3

MODEL_ID = "us.meta.llama3-2-90b-instruct-v1:0"
# MODEL_ID = "eu.meta.llama3-2-90b-instruct-v1:0"

IMAGE_NAME = "share-electricity-renewable-small.png"

bedrock_runtime = boto3.client("bedrock-runtime")

with open(IMAGE_NAME, "rb") as f:
    image = f.read()

user_message = "Based on this chart, which countries in Europe have the highest share?"

messages = [
    {
        "role": "user",
        "content": [
            {"image": {"format": "png", "source": {"bytes": image}}},
            {"text": user_message},
        ],
    }
]

response = bedrock_runtime.converse(
    modelId=MODEL_ID,
    messages=messages,
)
response_text = response["output"]["message"]["content"][0]["text"]
print(response_text)

Llama 3.2 models are also available in Amazon SageMaker JumpStart, a machine learning (ML) hub that makes it easy to deploy pre-trained models using the console or programmatically through the SageMaker Python SDK. From SageMaker JumpStart, you can also access and deploy new safeguard models that can help classify the safety level of model inputs (prompts) and outputs (responses), including Llama Guard 3 11B Vision, which are designed to support responsible innovation and system-level safety.

In addition, you can easily fine-tune Llama 3.2 1B and 3B models with SageMaker JumpStart today. Fine-tuned models can then be imported as custom models into Amazon Bedrock. Fine-tuning for the full collection of Llama 3.2 models in Amazon Bedrock and Amazon SageMaker JumpStart is coming soon.

The publicly available weights of Llama 3.2 models make it easier to deliver tailored solutions for custom needs. For example, you can fine-tune a Llama 3.2 model for a specific use case and bring it into Amazon Bedrock as a custom model, potentially outperforming other models in domain-specific tasks. Whether you’re fine-tuning for enhanced performance in areas like content creation, language understanding, or visual reasoning, Llama 3.2’s availability in Amazon Bedrock and SageMaker empowers you to create unique, high-performing AI capabilities that can set your solutions apart.

More on Llama 3.2 model architecture
Llama 3.2 builds upon the success of its predecessors with an advanced architecture designed for optimal performance and versatility:

Auto-regressive language model – At its core, Llama 3.2 uses an optimized transformer architecture, allowing it to generate text by predicting the next token based on the previous context.

Fine-tuning techniques – The instruction-tuned versions of Llama 3.2 employ two key techniques:

  • Supervised fine-tuning (SFT) – This process adapts the model to follow specific instructions and generate more relevant responses.
  • Reinforcement learning with human feedback (RLHF) – This advanced technique aligns the model’s outputs with human preferences, enhancing helpfulness and safety.

Multimodal capabilities – For the 11B and 90B Vision models, Llama 3.2 introduces a novel approach to image understanding:

  • Separately trained image reasoning adaptor weights are integrated with the core LLM weights.
  • These adaptors are connected to the main model through cross-attention mechanisms. Cross-attention allows one section of the model to focus on relevant parts of another component’s output, enabling information flow between different sections of the model.
  • When an image is input, the model treats the image reasoning process as a “tool use” operation, allowing for sophisticated visual analysis alongside text processing. In this context, tool use is the generic term used when a model uses external resources or functions to augment its capabilities and complete tasks more effectively.

Optimized inference – All models support grouped-query attention (GQA), which enhances inference speed and efficiency, particularly beneficial for the larger 90B model.

This architecture enables Llama 3.2 to handle a wide range of tasks, from text generation and understanding to complex reasoning and image analysis, all while maintaining high performance and adaptability across different model sizes.

Things to know
Llama 3.2 models from Meta are now generally available in Amazon Bedrock in the following AWS Regions:

  • Llama 3.2 1B and 3B models are available in the US West (Oregon) and Europe (Frankfurt) Regions, and are available in the US East (Ohio, N. Virginia) and Europe (Ireland, Paris) Regions via cross-region inference.
  • Llama 3.2 11B Vision and 90B Vision models are available in the US West (Oregon) Region, and are available in the US East (Ohio, N. Virginia) Regions via cross-region inference.

Check the full AWS Region list for future updates. To estimate your costs, visit the Amazon Bedrock pricing page.

To learn more about Llama 3.2 features and capabilities, visit the Llama models section of the Amazon Bedrock documentation. Give Llama 3.2 a try in the Amazon Bedrock console today, and send feedback to AWS re:Post for Amazon Bedrock.

You can find deep-dive technical content and discover how our Builder communities are using Amazon Bedrock at community.aws. Let us know what you build with Llama 3.2 in Amazon Bedrock!

Danilo

Announcing Llama 3.1 405B, 70B, and 8B models from Meta in Amazon Bedrock

Post Syndicated from Channy Yun original https://aws.amazon.com/blogs/aws/announcing-llama-3-1-405b-70b-and-8b-models-from-meta-in-amazon-bedrock/

Today, we are announcing the availability of Llama 3.1 models in Amazon Bedrock. The Llama 3.1 models are Meta’s most advanced and capable models to date. The Llama 3.1 models are a collection of 8B, 70B, and 405B parameter size models that demonstrate state-of-the-art performance on a wide range of industry benchmarks and offer new capabilities for your generative artificial intelligence (generative AI) applications.

All Llama 3.1 models support a 128K context length (an increase of 120K tokens from Llama 3) that has 16 times the capacity of Llama 3 models and improved reasoning for multilingual dialogue use cases in eight languages, including English, German, French, Italian, Portuguese, Hindi, Spanish, and Thai.

You can now use three new Llama 3.1 models from Meta in Amazon Bedrock to build, experiment, and responsibly scale your generative AI ideas:

  • Llama 3.1 405B (preview) is the world’s largest publicly available large language model (LLM) according to Meta. The model sets a new standard for AI and is ideal for enterprise-level applications and research and development (R&D). It is ideal for tasks like synthetic data generation where the outputs of the model can be used to improve smaller Llama models and model distillations to transfer knowledge to smaller models from the 405B model. This model excels at general knowledge, long-form text generation, multilingual translation, machine translation, coding, math, tool use, enhanced contextual understanding, and advanced reasoning and decision-making. To learn more, visit the AWS Machine Learning Blog about using Llama 3.1 405B to generate synthetic data for model distillation.
  • Llama 3.1 70B is ideal for content creation, conversational AI, language understanding, R&D, and enterprise applications. The model excels at text summarization and accuracy, text classification, sentiment analysis and nuance reasoning, language modeling, dialogue systems, code generation, and following instructions.
  • Llama 3.1 8B is best suited for limited computational power and resources. The model excels at text summarization, text classification, sentiment analysis, and language translation requiring low-latency inferencing.

Meta measured the performance of Llama 3.1 on over 150 benchmark datasets that span a wide range of languages and extensive human evaluations. As you can see in the following chart, Llama 3.1 outperforms Llama 3 in every major benchmarking category.

To learn more about Llama 3.1 features and capabilities, visit the Llama 3.1 Model Card from Meta and Llama models in the AWS documentation.

You can take advantage of Llama 3.1’s responsible AI capabilities, combined with the data governance and model evaluation features of Amazon Bedrock to build secure and reliable generative AI applications with confidence.

  • Guardrails for Amazon Bedrock – By creating multiple guardrails with different configurations tailored to specific use cases, you can use Guardrails to promote safe interactions between users and your generative AI applications by implementing safeguards customized to your use cases and responsible AI policies. With Guardrails for Amazon Bedrock, you can continually monitor and analyze user inputs and model responses that might violate customer-defined policies, detect hallucination in model responses that are not grounded in enterprise data or are irrelevant to the user’s query, and evaluate across different models including custom and third-party models. To get started, visit Create a guardrail in the AWS documentation.
  • Model evaluation on Amazon Bedrock – You can evaluate, compare, and select the best Llama models for your use case in just a few steps using either automatic evaluation or human evaluation. With model evaluation on Amazon Bedrock, you can choose automatic evaluation with predefined metrics such as accuracy, robustness, and toxicity. Alternatively, you can choose human evaluation workflows for subjective or custom metrics such as relevance, style, and alignment to brand voice. Model evaluation provides built-in curated datasets or you can bring in your own datasets. To get started, visit Get started with model evaluation in the AWS documentation.

To learn more about how to keep your data and applications secure and private in AWS, visit the Amazon Bedrock Security and Privacy page.

Getting started with Llama 3.1 models in Amazon Bedrock
If you are new to using Llama models from Meta, go to the Amazon Bedrock console and choose Model access on the bottom left pane. To access the latest Llama 3.1 models from Meta, request access separately for Llama 3.1 8B Instruct, Llama 3.1 70B Instruct, or Llama 3.1 405B Instruct.

To request to be considered for access to the preview of Llama 3.1 405B in Amazon Bedrock, contact your AWS account team or submit a support ticket via the AWS Management Console. When creating the support ticket, select Amazon Bedrock as the Service and Models as the Category.

To test the Llama 3.1 models in the Amazon Bedrock console, choose Text or Chat under Playgrounds in the left menu pane. Then choose Select model and select Meta as the category and Llama 3.1 8B Instruct, Llama 3.1 70B Instruct, or Llama 3.1 405B Instruct as the model.

In the following example I selected the Llama 3.1 405B Instruct model.

By choosing View API request, you can also access the model using code examples in the AWS Command Line Interface (AWS CLI) and AWS SDKs. You can use model IDs such as meta.llama3-1-8b-instruct-v1, meta.llama3-1-70b-instruct-v1 , or meta.llama3-1-405b-instruct-v1.

Here is a sample of the AWS CLI command:

aws bedrock-runtime invoke-model \
  --model-id meta.llama3-1-405b-instruct-v1:0 \
--body "{\"prompt\":\" [INST]You are a very intelligent bot with exceptional critical thinking[/INST] I went to the market and bought 10 apples. I gave 2 apples to your friend and 2 to the helper. I then went and bought 5 more apples and ate 1. How many apples did I remain with? Let's think step by step.\",\"max_gen_len\":512,\"temperature\":0.5,\"top_p\":0.9}" \
  --cli-binary-format raw-in-base64-out \
  --region us-east-1 \
  invoke-model-output.txt

You can use code examples for Llama models in Amazon Bedrock using AWS SDKs to build your applications using various programming languages. The following Python code examples show how to send a text message to Llama using the Amazon Bedrock Converse API for text generation.

import boto3
from botocore.exceptions import ClientError

# Create a Bedrock Runtime client in the AWS Region you want to use.
client = boto3.client("bedrock-runtime", region_name="us-east-1")

# Set the model ID, e.g., Llama 3 8b Instruct.
model_id = "meta.llama3-1-405b-instruct-v1:0"

# Start a conversation with the user message.
user_message = "Describe the purpose of a 'hello world' program in one line."
conversation = [
    {
        "role": "user",
        "content": [{"text": user_message}],
    }
]

try:
    # Send the message to the model, using a basic inference configuration.
    response = client.converse(
        modelId=model_id,
        messages=conversation,
        inferenceConfig={"maxTokens": 512, "temperature": 0.5, "topP": 0.9},
    )

    # Extract and print the response text.
    response_text = response["output"]["message"]["content"][0]["text"]
    print(response_text)

except (ClientError, Exception) as e:
    print(f"ERROR: Can't invoke '{model_id}'. Reason: {e}")
    exit(1)

You can also use all Llama 3.1 models (8B, 70B, and 405B) in Amazon SageMaker JumpStart. You can discover and deploy Llama 3.1 models with a few clicks in Amazon SageMaker Studio or programmatically through the SageMaker Python SDK. You can operate your models with SageMaker features such as SageMaker Pipelines, SageMaker Debugger, or container logs under your virtual private cloud (VPC) controls, which help provide data security.

The fine-tuning for Llama 3.1 models in Amazon Bedrock and Amazon SageMaker JumpStart will be coming soon. When you build fine-tuned models in SageMaker JumpStart, you will also be able to import your custom models into Amazon Bedrock. To learn more, visit Meta Llama 3.1 models are now available in Amazon SageMaker JumpStart on the AWS Machine Learning Blog.

For customers who want to deploy Llama 3.1 models on AWS through self-managed machine learning workflows for greater flexibility and control of underlying resources, AWS Trainium and AWS Inferentia-powered Amazon Elastic Compute Cloud (Amazon EC2) instances enable high performance, cost-effective deployment of Llama 3.1 models on AWS. To learn more, visit AWS AI chips deliver high performance and low cost for Meta Llama 3.1 models on AWS in the AWS Machine Learning Blog.

To celebrate this launch, Parkin Kent, Business Development Manager at Meta, talks about the power of the Meta and Amazon collaboration, highlighting how Meta and Amazon are working together to push the boundaries of what’s possible with generative AI.

Discover how businesses are leveraging Llama models in Amazon Bedrock to harness the power of generative AI. Nomura, a global financial services group spanning 30 countries and regions, is democratizing generative AI across its organization using Llama models in Amazon Bedrock.

Now available
Llama 3.1 8B and 70B models from Meta are generally available and Llama 450B model is preview today in Amazon Bedrock in the US West (Oregon) Region. To request to be considered for access to the preview of Llama 3.1 405B in Amazon Bedrock, contact your AWS account team or submit a support ticket. Check the full Region list for future updates. To learn more, check out the Llama in Amazon Bedrock product page and the Amazon Bedrock pricing page.

Give Llama 3.1 a try in the Amazon Bedrock console today, and send feedback to AWS re:Post for Amazon Bedrock or through your usual AWS Support contacts.

Visit our community.aws site to find deep-dive technical content and to discover how our Builder communities are using Amazon Bedrock in their solutions. Let me know what you build with Llama 3.1 in Amazon Bedrock!

Channy

AWS Weekly Roundup: Anthropic’s Claude 3 Opus in Amazon Bedrock, Meta Llama 3 in Amazon SageMaker JumpStart, and more (April 22, 2024)

Post Syndicated from Esra Kayabali original https://aws.amazon.com/blogs/aws/aws-weekly-roundup-anthropics-claude-3-opus-in-amazon-bedrock-meta-llama-3-in-amazon-sagemaker-jumpstart-and-more-april-22-2024/

AWS Summits continue to rock the world, with events taking place in various locations around the globe. AWS Summit London (April 24) is the last one in April, and there are nine more in May, including AWS Summit Berlin (May 15–16), AWS Summit Los Angeles (May 22), and AWS Summit Dubai (May 29). Join us to connect, collaborate, and learn about AWS!

While you decide which summit to attend, let’s look at the last week’s new announcements.

Last week’s launches
Last week was another busy one in the world of artificial intelligence (AI). Here are some launches that got my attention.

Anthropic’s Claude 3 Opus now available in Amazon Bedrock – After Claude 3 Sonnet and Claude 3 Haiku, two of the three state-of-the-art models of Anthropic’s Claude 3, Opus is now available in Amazon Bedrock. Cluade 3 Opus is at the forefront of generative AI, demonstrating comprehension and fluency on complicated tasks at nearly human levels. Like the rest of the Claude 3 family, Opus can process images and return text outputs. Claude 3 Opus shows an estimated twofold gain in accuracy over Claude 2.1 on difficult open-ended questions, reducing the likelihood of faulty responses.

Meta Llama 3 now available in Amazon SageMaker JumpStart – Meta Llama 3 is now available in Amazon SageMaker JumpStart, a machine learning (ML) hub that can help you accelerate your ML journey. You can deploy and use Llama 3 foundation models (FMs) with a few steps in Amazon SageMaker Studio or programmatically through the Amazon SageMaker Python SDK. Llama is available in two parameter sizes, 8B and 70B, and can be used to support a broad range of use cases, with improvements in reasoning, code generation, and instruction following. The model will be deployed in an AWS secure environment under your VPC controls, helping ensure data security.

Built-in SQL extension with Amazon SageMaker Studio Notebooks – SageMaker Studio’s JupyterLab now includes a built-in SQL extension to discover, explore, and transform data from various sources using SQL and Python directly within the notebooks. You can now seamlessly connect to popular data services and easily browse and search databases, schemas, tables, and views. You can also preview data within the notebook interface. New features such as SQL command completion, code formatting assistance, and syntax highlighting improve developer productivity. To learn more, visit Explore data with ease: Use SQL and Text-to-SQL in Amazon SageMaker Studio JupyterLab notebooks and the SageMaker Developer Guide.

AWS Split Cost Allocation Data for Amazon EKS – You can now receive granular cost visibility for Amazon Elastic Kubernetes Service (Amazon EKS) in the AWS Cost and Usage Reports (CUR) to analyze, optimize, and chargeback cost and usage for your Kubernetes applications. You can allocate application costs to individual business units and teams based on how Kubernetes applications consume shared Amazon EC2 CPU and memory resources. You can aggregate these costs by cluster, namespace, and other Kubernetes primitives to allocate costs to individual business units or teams. These cost details will be accessible in the CUR 24 hours after opt-in. You can use the Containers Cost Allocation dashboard to visualize the costs in Amazon QuickSight and the CUR query library to query the costs using Amazon Athena.

AWS KMS automatic key rotation enhancementsAWS Key Management Service (AWS KMS) introduces faster options for automatic symmetric key rotation. You can now customize rotation frequency between 90 days to 7 years, invoke key rotation on demand for customer-managed AWS KMS keys, and view the rotation history for any rotated AWS KMS key. There is a nice post on the Security Blog you can visit to learn more about this feature, including a little bit of history about cryptography.

Amazon Personalize automatic solution trainingAmazon Personalize now offers automatic training for solutions. With automatic training, you can set a cadence for your Amazon Personalize solutions to automatically retrain using the latest data from your dataset group. This process creates a newly trained machine learning (ML) model, also known as a solution version, and maintains the relevance of Amazon Personalize recommendations for end users. Automatic training mitigates model drift and makes sure recommendations align with users’ evolving behaviors and preferences. With Amazon Personalize, you can personalize your website, app, ads, emails, and more, using the same machine learning technology used by Amazon, without requiring any prior ML experience. To get started with Amazon Personalize, visit our documentation.

For a full list of AWS announcements, be sure to keep an eye on the What’s New at AWS page.

We launched existing services and instance types in additional Regions:

Other AWS news
Here are some additional news that you might find interesting:

The PartyRock Generative AI Hackathon winners – The PartyRock Generative AI Hackathon concluded with over 7,650 registrants submitting 1,200 projects across four challenge categories, featuring top winners like Parable Rhythm – The Interactive Crime Thriller, Faith – Manga Creation Tools, and Arghhhh! Zombie. Participants showed remarkable creativity and technical prowess, with prizes totaling $60,000 in AWS credits.

I tried the Faith – Manga Creation Tools app using my daughter Arya’s made-up stories and ideas and the result was quite impressive.

Visit Jeff Barr’s post to learn more about how to try the apps for yourself.

AWS open source news and updates – My colleague Ricardo writes about open source projects, tools, and events from the AWS Community. Check out Ricardo’s page for the latest updates.

Upcoming AWS events
Check your calendars and sign up for upcoming AWS events:

AWS Summits – Join free online and in-person events that bring the cloud computing community together to connect, collaborate, and learn about AWS. Register in your nearest city: Singapore (May 7), Seoul (May 16–17), Hong Kong (May 22), Milan (May 23), Stockholm (June 4), and Madrid (June 5).

AWS re:Inforce – Explore cloud security in the age of generative AI at AWS re:Inforce, June 10–12 in Pennsylvania for 2.5 days of immersive cloud security learning designed to help drive your business initiatives.

AWS Community Days – Join community-led conferences that feature technical discussions, workshops, and hands-on labs led by expert AWS users and industry leaders from around the world: Turkey (May 18), Midwest | Columbus (June 13), Sri Lanka (June 27), Cameroon (July 13), Nigeria (August 24), and New York (August 28).

You can browse all upcoming AWS led in-person and virtual events and developer-focused events here.

That’s all for this week. Check back next Monday for another Weekly Roundup!

— Esra

This post is part of our Weekly Roundup series. Check back each week for a quick roundup of interesting news and announcements from AWS!

AWS Weekly Roundup — AWS Chips Taste Test, generative AI updates, Community Days, and more — April 1, 2024

Post Syndicated from Channy Yun original https://aws.amazon.com/blogs/aws/aws-weekly-roundup-aws-chips-taste-test-generative-ai-updates-community-days-and-more-april-1-2024/

Today is April Fool’s Day. About 10 years ago, some tech companies would joke about an idea that was thought to be fun and unfeasible on April 1st, to the delight of readers. Jeff Barr has also posted seemingly far-fetched ideas on this blog in the past, and some of these have surprisingly come true! Here are examples:

Year Joke Reality
2010 Introducing QC2 – the Quantum Compute Cloud, a production-ready quantum computer to solve certain types of math and logic problems with breathtaking speed. In 2019, we launched Amazon Braket, a fully managed service that allows scientists, researchers, and developers to begin experimenting with computers from multiple quantum hardware providers in a single place.
2011 Announcing AWS $NAME, a scalable event service to find and automatically integrate with your systems on the cloud, on premises, and even your house and room. In 2019, we introduced Amazon EventBridge to make it easy for you to integrate your own AWS applications with third-party applications. If you use AWS IoT Events, you can monitor and respond to events at scale from your IoT devices at home.
2012 New Amazon EC2 Fresh Servers to deliver a fresh (physical) EC2 server in 15 minutes using atmospheric delivery and communucation from a fleet of satellites. In 2021, we launched AWS Outposts Server, 1U/2U physical servers with built-in AWS services. In 2023, Project Kuiper completed successful tests of an optical mesh network in low Earth orbit. Now, we only need to develop satellite warehouse and atmospheric re-entry technology to follow Amazon PrimeAir’s drone delivery.
2013 PC2 – The New Punched Card Cloud, a new mf (mainframe) instance family, Mainframe Machine Images (MMI), tape storage, and punched card interfaces for mainframe computers used from the 1970s to ’80s. In 2022, we launched AWS Mainframe Modernization to help you modernize your mainframe applications and deploy them to AWS fully managed runtime environments.

Jeff returns! This year, we have AWS “Chips” Taste Test for him to indulge in, drawing unique parallels between chip flavors and silicon innovations. He compared the taste of “Golden Nacho Cheese,” “Al Chili Lime,” and “BBQ Training Wheels” with AWS Graviton, AWS Inferentia, and AWS Trainium chips.

What’s your favorite? Watch a fun video in the LinkedIn and X post of AWS social media channels.

Last week’s launches
If we stay curious, keep learning, and insist on high standards, we will continue to see more ideas turn into reality. The same goes for the generative artificial intelligence (generative AI) world. Here are some launches that utilize generative AI technology this week.

Knowledge Bases for Amazon BedrockAnthropic’s Claude 3 Sonnet foundation model (FM) is now generally available on Knowledge Bases for Amazon Bedrock to connect internal data sources for Retrieval Augmented Generation (RAG).

Knowledge Bases for Amazon Bedrock support metadata filtering, which improves retrieval accuracy by ensuring the documents are relevant to the query. You can narrow search results by specifying which documents to include or exclude from a query, resulting in more relevant responses generated by FMs such as Claude 3 Sonnet.

Finally, you can customize prompts and number of retrieval results in Knowledge Bases for Amazon Bedrock. With custom prompts, you can tailor the prompt instructions by adding context, user input, or output indicator(s), for the model to generate responses that more closely match your use case needs. You can now control the amount of information needed to generate a final response by adjusting the number of retrieved passages. To learn more these new features, visit Knowledge bases for Amazon Bedrock in the AWS documentation.

Amazon Connect Contact Lens – At AWS re:Invent 2023, we previewed a generative AI capability to summarize long customer conversations into succinct, coherent, and context-rich contact summaries to help improve contact quality and agent performance. These generative AI–powered post-contact summaries are now available in Amazon Connect Contact Lens.

Amazon DataZone – At AWS re:Invent 2023, we also previewed a generative AI–based capability to generate comprehensive business data descriptions and context and include recommendations on analytical use cases. These generative AI–powered recommendations for descriptions are now available in Amazon DataZone.

There are also other important launches you shouldn’t miss:

A new Local Zone in Miami, Florida – AWS Local Zones are an AWS infrastructure deployment that places compute, storage, database, and other select services closer to large populations, industry, and IT centers where no AWS Region exists. You can now use a new Local Zone in Miami, Florida, to run applications that require single-digit millisecond latency, such as real-time gaming, hybrid migrations, and live video streaming. Enable the new Local Zone in Miami (use1-mia2-az1) from the Zones tab in the Amazon EC2 console settings to get started.

New Amazon EC2 C7gn metal instance – You can use AWS Graviton based new C7gn bare metal instances to run applications that benefit from deep performance analysis tools, specialized workloads that require direct access to bare metal infrastructure, legacy workloads not supported in virtual environments, and licensing-restricted business-critical applications. The EC2 C7gn metal size comes with 64 vCPUs and 128 GiB of memory.

AWS Batch multi-container jobs – You can use multi-container jobs in AWS Batch, making it easier and faster to run large-scale simulations in areas like autonomous vehicles and robotics. With the ability to run multiple containers per job, you get the advanced scaling, scheduling, and cost optimization offered by AWS Batch, and you can use modular containers representing different components like 3D environments, robot sensors, or monitoring sidecars.

Amazon Guardduty EC2 Runtime Monitoring – We are announcing the general availability of Amazon GuardDuty EC2 Runtime Monitoring to expand threat detection coverage for EC2 instances at runtime and complement the anomaly detection that GuardDuty already provides by continuously monitoring VPC Flow Logs, DNS query logs, and AWS CloudTrail management events. You now have visibility into on-host, OS-level activities and container-level context into detected threats.

GitLab support for AWS CodeBuild – You can now use GitLab and GitLab self-managed as the source provider for your CodeBuild projects. You can initiate builds from changes in source code hosted in your GitLab repositories. To get started with CodeBuild’s new source providers, visit the AWS CodeBuild User Guide.

Retroactive support for AWS cost allocation tags – You can enable AWS cost allocation tags retroactively for up to 12 months. Previously, when you activated resource tags for cost allocation purposes, the tags only took effect prospectively. Submit a backfill request, specifying the duration of time you want the cost allocation tags to be backfilled. Once the backfill is complete, the cost and usage data from prior months will be tagged with the current cost allocation tags.

For a full list of AWS announcements, be sure to keep an eye on the What’s New at AWS page.

Other AWS News
Some other updates and news about generative AI that you might have missed:

Amazon and Anthropic’s AI investiment – Read the latest milestone in our strategic collaboration and investment with Anthropic. Now, Anthropic is using AWS as its primary cloud provider and will use AWS Trainium and Inferentia chips for mission-critical workloads, including safety research and future FM development. Earlier this month, we announced access to Anthropic’s most powerful FM, Claude 3, on Amazon Bedrock. We announced availability of Sonnet on March 4 and Haiku on March 13. To learn more, watch the video introducing Claude on Amazon Bedrock.

Virtual building assistant built on Amazon Bedrock – BrainBox AI announced the launch of ARIA (Artificial Responsive Intelligent Assistant) powered by Amazon Bedrock. ARIA is designed to enhance building efficiency by assimilating seamlessly into the day-to-day processes related to building management. To learn more, read the full customer story and watch the video on how to reduce a building’s CO2 footprint with ARIA.

Solar models available on Amazon SageMaker JumpStart – Upstage Solar is a large language model (LLM) 100 percent pre-trained with Amazon SageMaker that outperforms and uses its compact size and powerful track record to specialize in purpose training, making it versatile across languages, domains, and tasks. Now, Solar Mini is available on Amazon SageMaker JumpStart. To learn more, watch how to deploy Solar models in SageMaker JumpStart.

AWS open source news and updates – My colleague Ricardo writes this weekly open source newsletter in which he highlights new open source projects, tools, and demos from the AWS Community. Last week’s highlight was news that Linux Foundation launched Valkey community, an open source alternative to the Redis in-memory, NoSQL data store.

Upcoming AWS Events
Check your calendars and sign up for upcoming AWS events:

AWS SummitAWS Summits – Join free online and in-person events that bring the cloud computing community together to connect, collaborate, and learn about AWS. Register in your nearest city: Paris (April 3), Amsterdam (April 9), Sydney (April 10–11), London (April 24), Berlin (May 15–16), and Seoul (May 16–17), Hong Kong (May 22), Milan (May 23), Dubai (May 29), Stockholm (June 4), and Madrid (June 5).

AWS re:Inforce – Explore cloud security in the age of generative AI at AWS re:Inforce, June 10–12 in Pennsylvania for two-and-a-half days of immersive cloud security learning designed to help drive your business initiatives. Read the story from AWS Chief Information Security Officer (CISO) Chris Betz about a bit of what you can expect at re:Inforce.

AWS Community Days – Join community-led conferences that feature technical discussions, workshops, and hands-on labs led by expert AWS users and industry leaders from around the world: Mumbai (April 6), Poland (April 11), Bay Area (April 12), Kenya (April 20), and Turkey (May 18).

You can browse all upcoming AWS led in-person and virtual events and developer-focused events such as AWS DevDay.

That’s all for this week. Check back next Monday for another Week in Review!

— Channy

This post is part of our Week in Review series. Check back each week for a quick roundup of interesting news and announcements from AWS.

Preprocess and fine-tune LLMs quickly and cost-effectively using Amazon EMR Serverless and Amazon SageMaker

Post Syndicated from Shijian Tang original https://aws.amazon.com/blogs/big-data/preprocess-and-fine-tune-llms-quickly-and-cost-effectively-using-amazon-emr-serverless-and-amazon-sagemaker/

Large language models (LLMs) are becoming increasing popular, with new use cases constantly being explored. In general, you can build applications powered by LLMs by incorporating prompt engineering into your code. However, there are cases where prompting an existing LLM falls short. This is where model fine-tuning can help. Prompt engineering is about guiding the model’s output by crafting input prompts, whereas fine-tuning is about training the model on custom datasets to make it better suited for specific tasks or domains.

Before you can fine-tune a model, you need to find a task-specific dataset. One dataset that is commonly used is the Common Crawl dataset. The Common Crawl corpus contains petabytes of data, regularly collected since 2008, and contains raw webpage data, metadata extracts, and text extracts. In addition to determining which dataset should be used, cleansing and processing the data to the fine-tuning’s specific need is required.

We recently worked with a customer who wanted to preprocess a subset of the latest Common Crawl dataset and then fine-tune their LLM with cleaned data. The customer was looking for how they could achieve this in the most cost-effective way on AWS. After discussing the requirements, we recommended using Amazon EMR Serverless as their platform for data preprocessing. EMR Serverless is well suited for large-scale data processing and eliminates the need for infrastructure maintenance. In terms of cost, it only charges based on the resources and duration used for each job. The customer was able to preprocess hundreds of TBs of data within a week using EMR Serverless. After they preprocessed the data, they used Amazon SageMaker to fine-tune the LLM.

In this post, we walk you through the customer’s use case and architecture used.

Solution overview

In the following sections, we first introduce the Common Crawl dataset and how to explore and filter the data we need. Amazon Athena only charges for the data size it scans and is used to explore and filter the data quickly, while being cost-effective. EMR Serverless provides a cost-efficient and no-maintenance option for Spark data processing, and is used to process the filtered data. Next, we use Amazon SageMaker JumpStart to fine-tune the Llama 2 model with the preprocessed dataset. SageMaker JumpStart provides a set of solutions for the most common use cases that can be deployed with just a few clicks. You don’t need to write any code to fine-tune an LLM such as Llama 2. Finally, we deploy the fine-tuned model using Amazon SageMaker and compare the differences in text output for the same question between the original and fine-tuned Llama 2 models.

The following diagram illustrates the architecture of this solution.

Prerequisites

Before you dive deep into the solution details, complete the following prerequisite steps:

  1. Create an Amazon Simple Storage Service (Amazon S3) bucket to store the cleaned dataset. For instructions, refer to Create your first S3 bucket.
  2. Set up Athena to run interactive SQL.
  3. Create an EMR Serverless environment.
  4. Prepare Amazon SageMaker Studio to fine-tune your LLM and run Jupyter notebooks. For instructions, refer to Get started.

The Common Crawl dataset

Common Crawl is an open corpus dataset obtained by crawling over 50 billion webpages. It includes massive amounts of unstructured data in multiple languages, starting from 2008 and reaching the petabyte level. It is continuously updated.

In the training of GPT-3, the Common Crawl dataset accounts for 60% of its training data, as shown in the following diagram (source: Language Models are Few-Shot Learners).

Another important dataset worth mentioning is the C4 dataset. C4, short for Colossal Clean Crawled Corpus, is a dataset derived from postprocessing the Common Crawl dataset. In Meta’s LLaMA paper, they outlined the datasets used, with Common Crawl accounting for 67% (utilizing 3.3 TB of data) and C4 for 15% (utilizing 783 GB of data). The paper emphasizes the significance of incorporating differently preprocessed data for enhancing model performance. Despite the original C4 data being part of Common Crawl, Meta opted for the reprocessed version of this data.

In this section, we cover common ways to interact, filter, and process the Common Crawl dataset.

Common Crawl data

The Common Crawl raw dataset includes three types of data files: raw webpage data (WARC), metadata (WAT), and text extraction (WET).

Data collected after 2013 is stored in WARC format and includes corresponding metadata (WAT) and text extraction data (WET). The dataset is located in Amazon S3, updated on a monthly basis, and can be accessed directly through AWS Marketplace.

For example, the following snippet is data from June of 2023:

$  aws s3 ls s3://commoncrawl/crawl-data/CC-MAIN-2023-23/
PRE segments/
2023-06-21  00:34:08       2164  cc-index-table.paths.gz
2023-06-21  00:34:08        637 cc-index.paths.gz
2023-06-21  05:52:05       2724 index.html
2023-06-21  00:34:09     161064  non200responses.paths.gz
2023-06-21  00:34:10     160888 robotstxt.paths.gz
2023-06-21  00:34:10        480 segment.paths.gz
2023-06-21  00:34:11     161082 warc.paths.gz
2023-06-21  00:34:12     160895 wat.paths.gz
2023-06-21  00:34:12     160898 wet.paths.gz

cc-index-table

The Common Crawl dataset also provides an index table for filtering data, which is called cc-index-table.

The cc-index-table is an index of the existing data, providing a table-based index of WARC files. It allows for easy lookup of information, such as which WARC file corresponds to a specific URL.

The Common Crawl GitHub repo provides corresponding Athena statements to query the index. For explanations of each field, refer to Common Crawl Index Athena.

For example, you can create an Athena table to map cc-index data with the following code:

CREATE  EXTERNAL TABLE IF NOT EXISTS ccindex (
  url_surtkey                   STRING,
  url                           STRING,
  url_host_name                 STRING,
  url_host_tld                  STRING,
  url_host_2nd_last_part        STRING,
  url_host_3rd_last_part        STRING,
  url_host_4th_last_part        STRING,
  url_host_5th_last_part        STRING,
  url_host_registry_suffix      STRING,
  url_host_registered_domain    STRING,
  url_host_private_suffix       STRING,
  url_host_private_domain       STRING,
  url_host_name_reversed        STRING,
  url_protocol                  STRING,
  url_port                      INT,
  url_path                      STRING,
  url_query                     STRING,
  fetch_time                    TIMESTAMP,
  fetch_status                  SMALLINT,
  fetch_redirect                STRING,
  content_digest                STRING,
  content_mime_type             STRING,
  content_mime_detected         STRING,
  content_charset               STRING,
  content_languages             STRING,
  content_truncated             STRING,
  warc_filename                 STRING,
  warc_record_offset            INT,
  warc_record_length            INT,
  warc_segment                  STRING)
PARTITIONED  BY (
  crawl                         STRING,
  subset                        STRING)
STORED  AS parquet
LOCATION  's3://commoncrawl/cc-index/table/cc-main/warc/';
 
# add partitions
MSCK  REPAIR TABLE ccindex

# query
select  * from ccindex 
where  crawl = 'CC-MAIN-2018-05' 
  and  subset = 'warc' 
  and  url_host_tld = 'no' 
limit  10

The preceding SQL statements demonstrate how to create an Athena table, add partitions, and run a query.

Filter data from the Common Crawl dataset

As you can see from the create table SQL statement, there are several fields that can help filter the data. For example, if you want to get the count of Chinese documents during a specific period, then the SQL statement could be as follows:

SELECT
  url,
  warc_filename,
  content_languages
FROM  ccindex
WHERE  (crawl = 'CC-MAIN-2023-14'
  OR crawl = 'CC-MAIN-2023-23')
  AND subset = 'warc'
  AND content_languages ='zho'
LIMIT  10000

If you want to do further processing, you can save the results to another S3 bucket.

Analyze the filtered data

The Common Crawl GitHub repository provides several PySpark examples for processing the raw data.

Let’s look at an example of running server_count.py (example script provided by the Common Crawl GitHub repo) on the data located in s3://commoncrawl/crawl-data/CC-MAIN-2023-23/segments/1685224643388.45/warc/.

First, you need a Spark environment, such as EMR Spark. For example, you can launch an Amazon EMR on EC2 cluster in us-east-1 (because the dataset is in us-east-1). Using an EMR on EC2 cluster can help you carry out tests before submitting jobs to the production environment.

After launching an EMR on EC2 cluster, you need to do an SSH login to the primary node of the cluster. Then, package the Python environment and submit the script (refer to the Conda documentation to install Miniconda):

#  create conda environment
conda  create -y -n example -c dmnapolitano python=3.7 botocore boto3 ujson requests  conda-pack warcio

#  package the conda env
conda  activate example
conda  pack -o environment.tar.gz

#  get script from common crawl github
git  clone https://github.com/commoncrawl/cc-pyspark.git

#  copy target file path to local
aws  s3 cp s3://commoncrawl/crawl-data/CC-MAIN-2023-23/warc.paths.gz .
gzip  -d warc.paths.gz

#  put warc list to hdfs
hdfs  dfs -put warc.paths

#  submit job
spark-submit  --conf spark.yarn.appMasterEnv.PYSPARK_PYTHON=./environment/bin/python \
--conf spark.sql.warehouse.dir=s3://xxxx-common-crawl/output/  \
--master yarn \ 
--deploy-mode cluster \
--archives environment.tar.gz#environment \
--py-files cc-pyspark/sparkcc.py  cc-pyspark/server_count.py --input_base_url  s3://commoncrawl/ ./warc.paths count_demo

It can take time to process all references in the warc.path. For demo purposes, you can improve the processing time with the following strategies:

  • Download the file s3://commoncrawl/crawl-data/CC-MAIN-2023-23/warc.paths.gz to your local machine, unzip it, and then upload it to HDFS or Amazon S3. This is because the .gzip file is not splitable. You need to unzip it to process this file in parallel.
  • Modify the warc.path file, delete most of its lines, and only keep two lines to make the job run much faster.

After the job is complete, you can see the result in s3://xxxx-common-crawl/output/, in Parquet format.

Implement customized possessing logic

The Common Crawl GitHub repo provides a common approach to process WARC files. Generally, you can extend the CCSparkJob to override a single method (process_record), which is sufficient for many cases.

Let’s look at an example to get the IMDB reviews of recent movies. First, you need to filter out files on the IMDB site:

SELECT
  url,
  warc_filename,
  url_host_name
FROM  ccindex
WHERE  (crawl = 'CC-MAIN-2023-06'
  OR crawl = 'CC-MAIN-2023-40')
  AND subset = 'warc'
  AND url like  'https://www.imdb.com/title/%/reviews'
LIMIT  1000

Then you can get WARC file lists that contain IMDB review data, and save the WARC file names as a list in a text file.

Alternatively, you can use EMR Spark get the WARC file list and store it in Amazon S3. For example:

sql  = """SELECT
  warc_filename
FROM  ccindex
WHERE  (crawl = 'CC-MAIN-2023-06'
  OR crawl = 'CC-MAIN-2023-40')
  AND subset = 'warc'
  AND url like  'https://www.imdb.com/title/%/reviews'
"""

warc_list  = spark.sql(sql)

#  write result list to s3
warc_list.coalesce(1).write.mode("overwrite").text("s3://xxxx-common-crawl/warclist/imdb_warclist")

The output file should look similar to s3://xxxx-common-crawl/warclist/imdb_warclist/part-00000-6af12797-0cdc-4ef2-a438-cf2b935f2ffd-c000.txt.

The next step is to extract user reviews from these WARC files. You can extend the CCSparkJob to override the process_record() method:

from  sparkcc import CCSparkJob
from  bs4 import BeautifulSoup
from  urllib.parse import urlsplit
 
class  IMDB_Extract_Job(CCSparkJob):
    name = "IMDB_Reviews"
 
    def process_record(self, record):
        if self.is_response_record(record):
            # WARC response record
            domain =  urlsplit(record.rec_headers['WARC-Target-URI']).hostname
            if domain == 'www.imdb.com':
                # get web contents
                contents = (
                    record.content_stream()
                        .read()
                        .decode("utf-8", "replace")
                )
 
                # parse with beautiful soup
                soup =  BeautifulSoup(contents, "html.parser")
 
                # get reviews
                review_divs =  soup.find_all(class_="text show-more__control")
                for div in review_divs:
                    yield div.text,1
 
 
if  __name__ == "__main__":
    job = IMDB_Extract_Job()
    job.run()

You can save the preceding script as imdb_extractor.py, which you’ll use in the following steps. After you have prepared the data and scripts, you can use EMR Serverless to process the filtered data.

EMR Serverless

EMR Serverless is a serverless deployment option to run big data analytics applications using open source frameworks like Apache Spark and Hive without configuring, managing, and scaling clusters or servers.

With EMR Serverless, you can run analytics workloads at any scale with automatic scaling that resizes resources in seconds to meet changing data volumes and processing requirements. EMR Serverless automatically scales resources up and down to provide the right amount of capacity for your application, and you only pay for what you use.

Processing the Common Crawl dataset is generally a one-time processing task, making it suitable for EMR Serverless workloads.

Create an EMR Serverless application

You can create an EMR Serverless application on the EMR Studio console. Complete the following steps:

  1. On the EMR Studio console, choose Applications under Serverless in the navigation pane.
  2. Choose Create application.

  1. Provide a name for the application and choose an Amazon EMR version.

  1. If access to VPC resources is required, add a customized network setting.

  1. Choose Create application.

Your Spark serverless environment will then be ready.

Before you can submit a job to EMR Spark Serverless, you still need to create an execution role. Refer to Getting started with Amazon EMR Serverless for more details.

Process Common Crawl data with EMR Serverless

After your EMR Spark Serverless application is ready, complete the following steps to process the data:

  1. Prepare a Conda environment and upload it to Amazon S3, which will be used as the environment in EMR Spark Serverless.
  2. Upload the scripts to be run to an S3 bucket. In the following example, there are two scripts:
    1. imbd_extractor.py – Customized logic to extract contents from the dataset. The contents can be found earlier in this post.
    2. cc-pyspark/sparkcc.py – The example PySpark framework from the Common Crawl GitHub repo, which is necessary to be included.
  3. Submit the PySpark job to EMR Serverless Spark. Define the following parameters to run this example in your environment:
    1. application-id – The application ID of your EMR Serverless application.
    2. execution-role-arn – Your EMR Serverless execution role. To create it, refer to Create a job runtime role.
    3. WARC file location – The location of your WARC files. s3://xxxx-common-crawl/warclist/imdb_warclist/part-00000-6af12797-0cdc-4ef2-a438-cf2b935f2ffd-c000.txt contains the filtered WARC file list, which you obtained earlier in this post.
    4. spark.sql.warehouse.dir – The default warehouse location (use your S3 directory).
    5. spark.archives – The S3 location of the prepared Conda environment.
    6. spark.submit.pyFiles – The prepared PySpark script sparkcc.py.

See the following code:

# 1. create conda environment
conda  create -y -n imdb -c dmnapolitano python=3.7 botocore boto3 ujson requests  conda-pack warcio bs4
 
# 2. package the conda  env, and upload to s3
conda  activate imdb 
conda  pack -o imdbenv.tar.gz
aws  s3 cp imdbenv.tar.gz s3://xxxx-common-crawl/env/
 
# 3. upload scripts to S3
aws  s3 cp imdb_extractor.py s3://xxxx-common-crawl/scripts/
aws  s3 cp cc-pyspark/sparkcc.py s3://xxxx-common-crawl/scripts/
 
# 4. submit job to EMR Serverless
#!/bin/bash
aws  emr-serverless start-job-run \
    --application-id 00fdsobht2skro2l \
    --execution-role-arn  arn:aws:iam::xxxx:role/EMR-Serverless-JobExecutionRole \
    --name imdb-retrive \
    --job-driver '{
        "sparkSubmit": {
          "entryPoint":  "s3://xxxx-common-crawl/scripts/imdb_extractor.py",
          "entryPointArguments":  ["--input_base_url" ,"s3://commoncrawl/",  "s3://xxxx-common-crawl/warclist/imdb_warclist/part-00000-6af12797-0cdc-4ef2-a438-cf2b935f2ffd-c000.txt",  "imdb_reviews", "--num_output_partitions",  "1"],
          "sparkSubmitParameters":  "--conf spark.sql.warehouse.dir=s3://xxxx-common-crawl/output/ --conf  spark.network.timeout=10000000 —conf  spark.executor.heartbeatInterval=10000000 —conf spark.executor.instances=100  —conf spark.executor.cores=4 —conf spark.executor.memory=16g —conf  spark.driver.memory=16g   —conf  spark.archives=s3://xxxx-common-crawl/env/imdbenv.tar.gz#environment —conf  spark.emr-serverless.driverEnv.PYSPARK_DRIVER_PYTHON=./environment/bin/python  —conf spark.emr-serverless.driverEnv.PYSPARK_PYTHON=./environment/bin/python  —conf spark.executorEnv.PYSPARK_PYTHON=./environment/bin/python —conf  spark.submit.pyFiles=s3://xxxx-common-crawl/scripts/sparkcc.py“
        }
}'

After the job is complete, the extracted reviews are stored in Amazon S3. To check the contents, you can use Amazon S3 Select, as shown in the following screenshot.

Considerations

The following are the points to consider when dealing with massive amounts of data with customized code:

  • Some third-party Python libraries may not be available in Conda. In such cases, you can switch to a Python virtual environment to build the PySpark runtime environment.
  • If there is a massive amount of data to be processed, try to create and use multiple EMR Serverless Spark applications to parallelize it. Each application deals with a subset of file lists.
  • You may encounter a slowdown issue with Amazon S3 when filtering or processing the Common Crawl data. This is because the S3 bucket storing the data is publicly accessible, and other users may access the data at the same time. To mitigate this issue, you can add a retry mechanism or sync specific data from the Common Crawl S3 bucket to your own bucket.

Fine-tune Llama 2 with SageMaker

After the data is prepared, you can fine-tune a Llama 2 model with it. You can do so using SageMaker JumpStart, without writing any code. For more information, refer to Fine-tune Llama 2 for text generation on Amazon SageMaker JumpStart.

In this scenario, you carry out a domain adaption fine-tuning. With this dataset, input consists of a CSV, JSON, or TXT file. You need to put all review data in a TXT file. To do so, you can submit a straightforward Spark job to EMR Spark Serverless. See the following sample code snippet:

# disable generating _SUCCESS file
spark.conf.set("mapreduce.fileoutputcommitter.marksuccessfuljobs",  "false")

data  = spark.read.parquet("s3://xxxx-common-crawl/output/imdb_reviews/")

data.select('Key').coalesce(1).write.mode("overwrite").text("s3://xxxx-common-crawl/llama2/train/")

After you prepare the training data, enter the data location for Training data set, then choose Train.

You can track the training job status.

Evaluate the fine-tuned model

After training is complete, choose Deploy in SageMaker JumpStart to deploy your fine-tuned model.

After the model is successfully deployed, choose Open Notebook, which redirects you to a prepared Jupyter notebook where you can run your Python code.

You can use the image Data Science 2.0 and the Python 3 kernel for the notebook.

Then, you can evaluate the fine-tuned model and the original model in this notebook.

endpoint_name_original = "jumpstart-dft-meta-textgeneration-llama-2-7b-origin"
endpoint_name_fine_tuned = "jumpstart-ftc-meta-textgeneration-llama-2-7b"

payload = {
    "inputs": "The review of movie 'A Woman of Paris: A Drama of Fate' is ",
    "parameters": {
        "max_new_tokens": 256,
        "top_p": 0.9,
        "temperature": 0.6,
        "return_full_text": True,
    },
        }
    
def query_endpoint(payload, endpoint_name):
    client = boto3.client("sagemaker-runtime")
    response = client.invoke_endpoint(
        EndpointName=endpoint_name,
        ContentType="application/json",
        Body=json.dumps(payload),
        CustomAttributes="accept_eula=true",
    )
    response = response["Body"].read().decode("utf8")
    response = json.loads(response)
    print(endpoint_name + ": \n" + response[0]['generation'])


query_endpoint(payload, endpoint_name_original)
print("\n-----#################-----\n")
query_endpoint(payload, endpoint_name_fine_tuned)

The following are two responses returned by the original model and fine-tuned model for the same question.

We provided both models with the same sentence: “The review of movie ‘A Woman of Paris: A Drama of Fate’ is” and let them complete the sentence.

The original model outputs meaningless sentences:

"The review of movie 'A woman of Paris: A Drama of Fate' is 3.0/5.

A Woman of Paris: A Drama of Fate(1923)

A Woman of Paris: A Drama of Fate movie released on 17 October, 1992. The movie is directed by. A Woman of Paris: A Drama of Fate featured Jeanne Eagles, William Haines, Burr McIntosh and Jack Rollens in lead rols.

..."

In contrast, the fine-tuned model’s outputs are more like a movie review:

" The review of movie 'A Woman of Paris: A Drama of Fate' is 6.3/10. I liked the story, the plot, the character, the background. The performances are amazing. Rory (Judy Davis) is an Australian photographer who travels to Africa to photograph the people, wildlife, and scenery. She meets Peter (Donald Sutherland), a zoologist, and they begin a relationship..."

Obviously, the fine-tuned model performs better in this specific scenario.

Clean up

After you finish this exercise, complete the following steps to clean up your resources:

  1. Delete the S3 bucket that stores the cleaned dataset.
  2. Stop the EMR Serverless environment.
  3. Delete the SageMaker endpoint that hosts the LLM model.
  4. Delete the SageMaker domain that runs your notebooks.

The application you created should stop automatically after 15 minutes of inactivity by default.

Generally, you don’t need to clean up the Athena environment because there are no charges when you’re not using it.

Conclusion

In this post, we introduced the Common Crawl dataset and how to use EMR Serverless to process the data for LLM fine-tuning. Then we demonstrated how to use SageMaker JumpStart to fine-tune the LLM and deploy it without any code. For more use cases of EMR Serverless, refer to Amazon EMR Serverless. For more information about hosting and fine-tuning models on Amazon SageMaker JumpStart, refer to the Sagemaker JumpStart documentation.


About the Authors

Shijian Tang is a Analytics Specialist Solution Architect at Amazon Web Services.

Matthew Liem is a Senior Solution Architecture Manager at Amazon Web Services.

Dalei Xu is a Analytics Specialist Solution Architect at Amazon Web Services.

Yuanjun Xiao is a Senior Solution Architect at Amazon Web Services.

AWS Weekly Roundup: AWS Control Tower, Amazon Bedrock, Amazon OpenSearch Service, and More (October 9, 2023)

Post Syndicated from Antje Barth original https://aws.amazon.com/blogs/aws/aws-weekly-roundup-aws-control-tower-amazon-bedrock-amazon-opensearch-service-and-more-october-9-2023/

Pumpkins

As the Northern Hemisphere enjoys early fall and pumpkins take over the local farmers markets and coffee flavors here in the United States, we’re also just 50 days away from re:Invent 2023! But before we officially enter pre:Invent sea­­son, let’s have a look at some of last week’s exciting news and announcements.

Last Week’s Launches
Here are some launches that got my attention:

AWS Control Tower – AWS Control Tower released 22 proactive controls and 10 AWS Security Hub detective controls to help you meet regulatory requirements and meet control objectives such as encrypting data in transit, encrypting data at rest, or using strong authentication. For more details and a list of controls, check out the AWS Control Tower user guide.

Amazon Bedrock – Just a week after Amazon Bedrock became available in AWS Regions US East (N. Virginia) and US West (Oregon), Amazon Bedrock is now also available in the Asia Pacific (Tokyo) AWS Region. To get started building and scaling generative AI applications with foundation models, check out the Amazon Bedrock documentation, explore the generative AI space at community.aws, and get hands-on with the Amazon Bedrock workshop.

Amazon OpenSearch Service – You can now run OpenSearch version 2.9 in Amazon OpenSearch Service with improvements to search, observability, security analytics, and machine learning (ML) capabilities. OpenSearch Service has expanded its geospatial aggregations support in version 2.9 to gather insights on high-level overview of trends and patterns and establish correlations within the data. OpenSearch Service 2.9 now also comes with OpenSearch Service Integrations to take advantage of new schema standards such as OpenTelemetry and supports managing and overlaying alerts and anomalies onto dashboard visualization line charts.

Amazon SageMakerSageMaker Feature Store now supports a fully managed, in-memory online store to help you retrieve features for model serving in real time for high throughput ML applications. The new online store is powered by ElastiCache for Redis, an in-memory data store built on open-source Redis. The SageMaker developer guide has all the details.

Also, SageMaker Model Registry added support for private model repositories. You can now register models that are stored in private Docker repositories and track all your models across multiple private AWS and non-AWS model repositories in one central service, simplifying ML operations (MLOps) and ML governance at scale. The SageMaker Developer Guide shows you how to get started.

Amazon SageMaker CanvasSageMaker Canvas expanded its support for ready-to-use models to include foundation models (FMs). You can now access FMs such as Claude 2, Amazon Titan, and Jurassic-2 (powered by Amazon Bedrock) as well as publicly available models such as Falcon and MPT (powered by SageMaker JumpStart) through a no-code chat interface. Check out the SageMaker Developer Guide for more details.

For a full list of AWS announcements, be sure to keep an eye on the What’s New at AWS page.

Other AWS News
Here are some additional blog posts and news items that you might find interesting:

Behind the scenes on AWS contributions to open-source databases – This post shares some of the more substantial open-source contributions AWS has made in the past two years to upstream databases, introduces some key contributors, and shares how AWS approaches upstream work in our database services.

Fast and cost-effective Llama 2 fine-tuning with AWS Trainium – This post shows you how to fine-tune the Llama 2 model from Meta on AWS Trainium, a purpose-built accelerator for LLM training, to reduce training times and costs.

Code Llama code generation models from Meta are now available via Amazon SageMaker JumpStart – You can now deploy Code Llama FMs, developed by Meta, with one click in SageMaker JumpStart. This post walks you through the details.

Upcoming AWS Events
Check your calendars and sign up for these AWS events:

Build On AWS - Generative AIBuild On Generative AI – Season 2 of this weekly Twitch show about all things generative AI is in full swing! Every Monday, 9:00 US PT, my colleagues Emily and Darko look at new technical and scientific patterns on AWS, invite guest speakers to demo their work, and show us how they built something new to improve the state of generative AI. In today’s episode, Emily and Darko discussed how to translate unstructured documents into structured data. Check out show notes and the full list of episodes on community.aws.

AWS Community Days – Join a community-led conference run by AWS user group leaders in your region: DMV (DC, Maryland, Virginia) (October 13), Italy (October 18), UAE (October 21), Jaipur (November 4), Vadodara (November 4), and Brasil (November 4).

AWS InnovateAWS Innovate: Every Application Edition – Join our free online conference to explore cutting-edge ways to enhance security and reliability, optimize performance on a budget, speed up application development, and revolutionize your applications with generative AI. Register for AWS Innovate Online Americas and EMEA on October 19 and AWS Innovate Online Asia Pacific & Japan on October 26.

AWS re:Invent 2023AWS re:Invent (November 27 – December 1) – Join us to hear the latest from AWS, learn from experts, and connect with the global cloud community. Browse the session catalog and attendee guides and check out the re:Invent highlights for generative AI.

You can browse all upcoming in-person and virtual events.

That’s all for this week. Check back next Monday for another Weekly Roundup!

— Antje

This post is part of our Weekly Roundup series. Check back each week for a quick roundup of interesting news and announcements from AWS!

New – Share ML Models and Notebooks More Easily Within Your Organization with Amazon SageMaker JumpStart

Post Syndicated from Antje Barth original https://aws.amazon.com/blogs/aws/new-share-ml-models-and-notebooks-more-easily-within-your-organization-with-amazon-sagemaker-jumpstart/

Amazon SageMaker JumpStart is a machine learning (ML) hub that can help you accelerate your ML journey. SageMaker JumpStart gives you access to built-in algorithms with pre-trained models from popular model hubs, pre-trained foundation models to help you perform tasks such as article summarization and image generation, and end-to-end solutions to solve common use cases.

Today, I’m happy to announce that you can now share ML artifacts, such as models and notebooks, more easily with other users that share your AWS account using SageMaker JumpStart.

Using SageMaker JumpStart to Share ML Artifacts
Machine learning is a team sport. You might want to share your models and notebooks with other data scientists in your team to collaborate and increase productivity. Or, you might want to share your models with operations teams to put your models into production. Let me show you how to share ML artifacts using SageMaker JumpStart.

In SageMaker Studio, select Models in the left navigation menu. Then, select Shared models and Shared by my organization. You can now discover and search ML artifacts that other users shared within your AWS account. Note that you can add and share ML artifacts developed with SageMaker as well as those developed outside of SageMaker.

To share a model or notebook, select Add. For models, provide basic information, such as title, description, data type, ML task, framework, and any additional metadata. This information helps other users to find the right models for their use cases. You can also enable training and deployment for your model. This allows users to fine-tune your shared model and deploy the model in just a few clicks through SageMaker JumpStart.

Amazon SageMaker Jumpstart - Add model to private ML hub

To enable model training, you can select an existing SageMaker training job that will autopopulate all relevant information. This information includes the container framework, training script location, model artifact location, instance type, default training and validation datasets, and target column. You can also provide custom model training information by selecting a prebuilt SageMaker Deep Learning Container or selecting a custom Docker container in Amazon ECR. You can also specify default hyperparameters and metrics for model training.

To enable model deployment, you also need to define the container image to use, the inference script and model artifact location, and the default instance type. Have a look at the SageMaker Developer Guide to learn more about model training and model deployment options.

Sharing a notebook works similarly. You need to provide basic information about your notebook and the Amazon S3 location of the notebook file.

Amazon SageMaker JumpStart - Add a notebook to private ML hub

Users that share your AWS account can now browse and select shared models to fine-tune, deploy endpoints, or run notebooks directly in SageMaker JumpStart.

In SageMaker Studio, select Quick start solutions in the left navigation menu, then select Solutions, models, example notebooks to access all shared ML artifacts, together with pre-trained models from popular model hubs and end-to-end solutions.

Amazon SageMaker JumpStart

Now Available
The new ML artifact-sharing capability within Amazon SageMaker JumpStart is available today in all AWS Regions where Amazon SageMaker JumpStart is available. To learn more, visit Amazon SageMaker JumpStart and the SageMaker JumpStart documentation.

Start sharing your models and notebooks with Amazon SageMaker JumpStart today!

— Antje

AWS Week in Review – November 14, 2022

Post Syndicated from Steve Roberts original https://aws.amazon.com/blogs/aws/aws-week-in-review-november-14-2022/

It’s now just two weeks to AWS re:Invent in Las Vegas, and the pace is picking up, both here on the News Blog, and throughout AWS as everyone get ready for the big event! I hope you get the chance to join us, and have shared links and other information at the bottom of this post. First, though, let’s dive straight in to this week’s review of news and announcements from AWS.

Last Week’s Launches
As usual, let’s start with a summary of some launches from the last week that I want to remind you of:

New Switzerland Region – First and foremost, AWS has opened a new Region, this time in Switzerland. Check out Seb’s post here on the News Blog announcing the launch.

New AWS Resource Explorer – if you’ve ever spent time searching for specific resources in your AWS account, especially across Regions, be sure to take a look at the new AWS Resource Explorer, described in this post by Danilo. Once enabled, indexes of the resources in your account are built and maintained (you have control over which resources are indexed). Once the indexes are built, you can issue queries to more quickly arrive at the required resource without jumping between different Regions and service dashboards in the Management Console.

Amazon Lightsail domain registration and DNS autoconfigurationAmazon Lightsail users can now take advantage of new support for registering domain names with automatic configuration of DNS records. Within the Lightsail console, you’re now able to create and register an Amazon Route 53 domain with just a few clicks. 

New models for Amazon SageMaker JumpStart – Two new state-of-the-art models have been released for Amazon SageMaker JumpStart. SageMaker JumpStart provides pretrained, open-source models covering a wide variety of problem types that help you get started with machine learning. The first new model, Bloom, can be used to complete sentences or generate long paragraphs of text in 46 different languages. The second model, Stable Diffusion, generates realistic images from given text. Find out more about the new models in this What’s New post.

Mac instances and macOS VenturaAmazon Elastic Compute Cloud (Amazon EC2) now has support for running the latest version of macOS, Ventura (13.0), for both EC2 x86 Mac and EC2 M1 Mac instances. These instances enable you to provision and run macOS environments in the AWS Cloud, for developers creating apps for iPhone, iPad, Mac, Apple Watch, Apple TV, and Safari.

For a full list of AWS announcements, be sure to keep an eye on the What’s New at AWS page.

Other AWS News
Some other news items you may want to explore:

AWS Open Source News and Updates – This blog is published each week, and Installment 135 is now available, highlighting new open-source projects, tools, and demos from the AWS community.

Upcoming AWS Events
AWS re:Invent 2022 – As I noted at the top of this post, we’re now just two weeks away from the event! Join us live in Las Vegas November 28–December 2 for keynotes, opportunities for training and certification, and over 1,500 technical sessions. If you are joining us, be sure to check out the re:Invent 2022 Attendee Guides, each curated by an AWS Hero, AWS industry team, or AWS partner.

If you can’t join us live in Las Vegas, be sure to join us online to watch the keynotes and leadership sessions. My cohosts and I on the AWS on Air show will also be livestreaming daily from the event, chatting with service teams and special guests about all the launches and other announcements. You can find us on Twitch.tv (we’ll be on the front page throughout the event), the AWS channel on LinkedIn Live, Twitter.com/awsonair, and YouTube Live.

And one final update for the event – if you’re a .NET developer, be sure to check out the XNT track in the session catalog to find details on the seven breakouts, three chalk talks, and the workshop we have available for you at the conference!

Check back next Monday for our last week in review before the start of re:Invent!

— Steve

This post is part of our Week in Review series. Check back each week for a quick roundup of interesting news and announcements from AWS.

AWS Week In Review – June 6, 2022

Post Syndicated from Antje Barth original https://aws.amazon.com/blogs/aws/aws-week-in-review-june-6-2022/

This post is part of our Week in Review series. Check back each week for a quick roundup of interesting news and announcements from AWS!

I’ve just come back from a long (extended) holiday weekend here in the US and I’m still catching up on all the AWS launches that happened this past week. I’m particularly excited about some of the data, machine learning, and quantum computing news. Let’s have a look!

Last Week’s Launches
The launches that caught my attention last week are the following:

Amazon EMR Serverless is now generally available Amazon EMR Serverless allows you to run big data applications using open-source frameworks such as Apache Spark and Apache Hive without configuring, managing, and scaling clusters. The new serverless deployment option for Amazon EMR automatically scales resources up and down to provide just the right amount of capacity for your application, and you only pay for what you use. To learn more, check out Channy’s blog post and listen to The Official AWS Podcast episode on EMR Serverless.

AWS PrivateLink is now supported by additional AWS services AWS PrivateLink provides private connectivity between your virtual private cloud (VPC), AWS services, and your on-premises networks without exposing your traffic to the public internet. The following AWS services just added support for PrivateLink:

  • Amazon S3 on Outposts has added support for PrivateLink to perform management operations on your S3 storage by using private IP addresses in your VPC. This eliminates the need to use public IPs or proxy servers. Read the June 1 What’s New post for more information.
  • AWS Panorama now supports PrivateLink, allowing you to access AWS Panorama from your VPC without using public endpoints. AWS Panorama is a machine learning appliance and software development kit (SDK) that allows you to add computer vision (CV) to your on-premises cameras. Read the June 2 What’s New post for more information.
  • AWS Backup has added PrivateLink support for VMware workloads, providing direct access to AWS Backup from your VMware environment via a private endpoint within your VPC. Read the June 3 What’s New post for more information.

Amazon SageMaker JumpStart now supports incremental model training and automatic tuning – Besides ready-to-deploy solution templates for common machine learning (ML) use cases, SageMaker JumpStart also provides access to more than 300 pre-trained, open-source ML models. You can now incrementally train all the JumpStart models with new data without training from scratch. Through this fine-tuning process, you can shorten the training time to reach a better model. SageMaker JumpStart now also supports model tuning with SageMaker Automatic Model Tuning from its pre-trained model, solution templates, and example notebooks. Automatic tuning allows you to automatically search for the best hyperparameter configuration for your model.

Amazon Transcribe now supports automatic language identification for multi-lingual audioAmazon Transcribe converts audio input into text using automatic speech recognition (ASR) technology. If your audio recording contains more than one language, you can now enable multi-language identification, which identifies all languages spoken in the audio file and creates a transcript using each identified language. Automatic language identification for multilingual audio is supported for all 37 languages that are currently supported for batch transcriptions. Read the What’s New post from Amazon Transcribe to learn more.

Amazon Braket adds support for Borealis, the first publicly accessible quantum computer that is claimed to offer quantum advantage – If you are interested in quantum computing, you’ve likely heard the term “quantum advantage.” It refers to the technical milestone when a quantum computer outperforms the world’s fastest supercomputers on a well-defined task. Until now, none of the devices claimed to demonstrate quantum advantage have been accessible to the public. The Borealis device, a new photonic quantum processing unit (QPU) from Xanadu, is the first publicly available quantum computer that is claimed to have achieved quantum advantage. Amazon Braket, the quantum computing service from AWS, has just added support for Borealis. To learn more about how you can test a quantum advantage claim for yourself now on Amazon Braket, check out the What’s New post covering the addition of Borealis support.

For a full list of AWS announcements, be sure to keep an eye on the What’s New at AWS page.

Other AWS News
Some other updates and news that you may have missed:

New AWS Heroes – A warm welcome to our newest AWS Heroes! The AWS Heroes program is a worldwide initiative that acknowledges individuals who have truly gone above and beyond to share knowledge in technical communities. Get to know them in the June 2022 introduction blog post!

AWS open-source news and updates – My colleague Ricardo Sueiras writes this weekly open-source newsletter in which he highlights new open-source projects, tools, and demos from the AWS Community. Read edition #115 here.

Upcoming AWS Events
Join me in Las Vegas for Amazon re:MARS 2022. The conference takes place June 21–24 and is all about the latest innovations in machine learning, automation, robotics, and space. I will deliver a talk on how machine learning can help to improve disaster response. Say “Hi!” if you happen to be around and see me.

We also have more AWS Summits coming up over the next couple of months, both in-person and virtual.

In Europe:

In North America:

In South America:

Find an AWS Summit near you, and get notified when registration opens in your area.

Imagine Conference 2022You can now register for IMAGINE 2022 (August 3, Seattle). The IMAGINE 2022 conference is a no-cost event that brings together education, state, and local leaders to learn about the latest innovations and best practices in the cloud.

Sign up for the SQL Server Database Modernization webinar on June 21 to learn how to modernize and cost-optimize Microsoft SQL Server on AWS.

That’s all for this week. Check back next Monday for another Week in Review!

— Antje